Description :
From Genome Similarity Track
Location :
Scaffold_56:36718- 38076
Sequence
1358 bases(100 bases per row)
GAATTCACGAATGTATTCTCTGAAATCAATCCATGCGAGTTTCCCAAGGAAAAAGGCACTCGACATGAGGTCGAGATGAAATCGGGCTCGAAGTACTGTG
TCACGCCTCGTGAACAAGTACTTGCTATCCATAAATTATTTTGTCGATCGCTTAGCAGCGGGATGTGTGAGGGAGTCACCCTCCCCTCATTGCTCTCCGA
CCTTCTTTCTGCGTAAGGCCACAGGAGGACGTCGGATAGTGCACGCATTCAACAAGACAGATGCTGCAAAAGTAGCGGCTAAAACGCCAATACCAAGAAA
GGACGTCATCATAGATGGTATAGCAAAGATTACCATGTTTCCGTCCATGGTTCTGGTGGATGGCTTCTATCCAATCCTTATGCGTGAAGGAGGCGTCCCC
TACACCTCAGTGAGATCCCAATTGGTTTGTTGTGGGAGTGAATAGTTATGACACGAGGGTTAAGTAATGCCCCTGACACATTCAACAGATGTTTTACAGA
TCTGTTGAGACCGATGCGAGGTTTTGCACCTAGTTACTTCGACGATGTGCTCGTCCATAGCCGGGCTATAGACGAAATTACGGACGTGGAAGTCCACCGA
ATCTTCATCCGTAAGTTTATTACACTTATGCGTGAGCATACGATGTACGCCAACCTCAAGAAGTGTATATTCGCGGCAAGAGAAATACCACTTCTTCGGT
ACATGGTCGGAATATACGGCGCACGTACCAATCCGGAAAAGACCAAGACAACCACCTACTATCCTGTACCATTTGATGTGAAGGGATTGGGAAGTTTCTT
GGAGTAGTGGTACTTGCACAATAATTGTGCAACAACGCAGAAATGACCATTCATCTCTGTCATTTGTTAAGAATAACGAAAACTGGTCATGGAACACTGG
GTGCCAAATTTCCTTTGAAGGTATCAAGCAGAGCTTAATCGCCCATACTGGTGATTACGGATCACGACACCATTCCATGTGGTCTTTGACGCAAGTGATT
ATGCAAGCGGCTGCGCGCTGACGCTATACGACCCAGATGGAGCTGGGCGCGTCACCTCCAGGCAGCTAAACGAATTTACCCAGTTCATAACAAGTAACTA
CTTGTCATGGTGGTGAATTATGCATTGGAGAAGTTCAGGGTCTATTTGTTAGGGGGATAGACCCTTCATCGTGTACACGGATTATGCGTCAATACGCACA
GCCGTAAACAGTCCACACCCTCTCAAAGAACGGCGAGGTAGCAGTCTTTTTTCGTGGAGTACAAATTCTTCTTGGAGTACAAGCCAGGGTGATTTATCGT
CGTTTCTGATGCGTTGTCGCGTCGACACGATTTCGAGCCAATTGCGCAACCCATCAGT