Description :
From Genome Similarity Track
Location :
scaffold_214:36716- 42623
Transcript NameFunction/comments
Pl_107592hypothetical protein PHYSODRAFT_297756
Pl_107593conserved hypothetical protein

Sequence
5907 bases(100 bases per row)
TGGTCTTATTTCGCCGGAACATGTGATGCACCAGTGCTGTTGACCAACAGTTTAGCACGAGAAGAACAACGTAAAAGCGGTTCAACCAAAGTCGAGGGAC
ATTCCGACTCATGCGAAGTCCTTGATTCGTTTGCAGTGTTGTTTCTATCGTTTCACGACACAGTAGCAACAAATCGTAGTATGGGCCTGCCGCCCCAAAA
AACCCTCGATGGCCAAATATTGCAATAAAACAGCGGTAGAAAATCCCCACAGGACCTCGACGTCTACGCTGAGTTTTGCGTCGACCTGTAGCGTGCAATT
GTGGATGTGAAGCAAAAGTACTACGAAAGGTAAATCTCTTATTCCGAATCGATCTCGAAATCATTGCGAACGCTGACAGCGCATGTAAACTCGCAATAAT
GCCATGTGTGATAGCAATGGCGTGATAGTGTCGAGAATTCATGCCGATCTGGTAGAAATCCAGAAACGTCGTGACCTCCAACCCGGGCATTTTCCAGTAG
GCCGTGAACACGAGTCCGAAGAATAGTCCACCCACAAGGTGAAGAGATAGCAAACCAACCCACCATAGTCGAATAGCAGTCGGTGTGAAGGGAACTTCCT
CCGTGGATCGAACTAGCAAGCTCAGTCTTGGTGCATTGTGTGCAGTTTCCATGGGTATTTGGCGAGGATGATCAAGTCTACGTCGACGTGACAACGACAA
TAATAACCTGGCACATGCAAATTCTTGACAAGGTTCCCAATCTAATTCTAGTTTATGAAGTGTGAATTATTAGCTGGTGCCAAAGTGAAAATCCCCAGCC
AACATCAGCCAACATCAGCCAACATCAGCCAAAACGACTAGAAGCGGTGGATTCATTTCACATGGCGATTCGAAAAGCACTATACTCAAAACCCCTGCGC
AATGGTTTCCTGTTCTCCTCACTCCACCAAAGATAATTATCAACACTTCCCAACTCCCATGCAAATGCTGTTGATTTGCGTTTACTTAGTTTACCAATGA
CACGTTTTTTTACTATTATAATGCATCGCAAATTTATGGGAAGACCTCAGAACCGTTGAGGCCATGTTTAGAGCGCAATAACGAAGTCAGAGCAGAACCA
CACCCATTTCCACTTTGTCTGCGGTGGAATGTCGTCAAAACAGAATTCTTTTACTAAAACTTCTTCCCAGTATGTGGATCTCTCGCGGAGGAATTTTGCA
ATTTGGTGGACAATGTTGTTCGTGGTGCACTTAGTGACAGGTGGATACAATGCAGCATTCGCGCTGTTTTATCATGAGCTCCAGCATACTTACCTGTACC
TGTGTCTGGACTATTCGGGAATTGGGATGCGGGCGAAAGACCATCAAGTAATATCCCTAGTAAATGCAGTTATGGCTGCTATTCATGGTGTATGTTTGCT
GCTGATGGTTGGTGGCTCGCTTTGGCATCGTGAATTAGTTTTCTCCCCATGGGGAAATGGCAAAAGTCAAACTGATAGGATTACCAAACTAACCGTAAAG
CCCAAGAATGGCAGTGCTCCACCAAAATCTCAGTTGTCTCGAGCTTATTCGAAGATTTTAGGGCGAAAAGGACTGATTGGTGTCAACGGAAACAGTTTCC
ACACGATCCTTCTCGCGCGTGAGTTTATGGAGACGGCACTACAAACAGTACAAGCTTATCGGATGAGTTGGTTGCTACCAAGAATGCTACTTAATCGATT
CTACTTAAGTCTGATTGTGCTAAATTGCTGGTCGTCTGTTTTGGTGTACTCGCTACTATTTAAACGAAACGAGGCGCGCAAGCGGTTTGCCTATCTCGTG
TGCGACTGCACATTGAATCTCGTGTCTTCTATCGGAGTGCCATTAATTGTTGTGTTTACCTACGTTGGCCAGTACGACAGTAAGATCACTGGCTTCCCTT
TAGAAAAATGGTACGATGACGAGTGGTCTGCGCGCGTTCTCAACGAATTTCAGATGATTGTCGTTGTTTCGTGGATGGACTTGGCCAGTCGAACAATATT
TTCGATCGGTGTGATTTCTACCACAAACAACCTGAAGGACCTCTTACGTAAGTCTCCGAGCGCCAGTTCAAGACGCATTGCATGCGATGCTGAACCTGCT
AAAATACAAAATGTCCAGGAAAACCCAGAAGTCATCCCTAAAACAACTTCAGGCATAGGACGAGCACAGCAAACAGCGAAAACGAGCAGCTGGCGAACAC
GGGCAGGACACAGCATAATGCGCGGGGCTTACAGCATTTTCGCATTGTGGGGTGTCGTAGTCATTGGGCTACATATACAAGCATCTGTGCAACCAGAACA
GCCACAATGTGCCTTGCAAGTGCGTCCATGGGCGGTGTCAAACCCAGCTTGCTACCTAGCAGTTCTTGACTGCCACCGCCTTGGCATATCTGGAAAGATA
GATGAAGTTGAGGCCAAATGGAATGAGTTTGACAGATCCACCGTTGTAACACTGGTGATCCGCCACTGCCCAGCTTTGGAAATCCCCGACACGATTGGAG
ATTTCCACATCACAACTGGTATCAAGGTGTATAACTCAACTATTTACGAGTGGAGGGAGTCAGCAGCAATTACAAACACCAACCATCCTAAAATGATTTG
GTTTTATCTTGTACGCGTCAACGTAACTGGTGGCATTCTACCAGCGGGAGTTTTATCGGCTGATTTCCCGTTTAACTTGTACGACCTCGAGTTCACCTAC
ACAAATGTGCGCGAATTGCCTGACGATCTCGATTCCAAGTGGTTACTTGGAACGACAGTGTATTTCGAGTACAGTGAGCTGACCAGTGTTCCGGATTCGT
TGGTTCGTCTTGAGCCTTATAGTATTTCACTAACAGGAAGCCCAATCACCGAGCTTCCACCAGAAGTCTTTGAAGTTGCAGGAATGGTATACATGTACAT
GGCGGGTATCAGTGTCAATGAGTTGCCTCGTGATGTCATAAACCTCTCACCCGACCTGGTGTATGTGGTTTTTGCCGATACAAACGTGTCATACATGTGG
CTGTGGGTTGATACACTCGTACAGAGTCAAATAGAATGGTCATCTCCACTCTTCATGGGCGGGTCACCATATTGCACTGACGTTGAGAAAATTACGAATG
GAGAAGCAGATACATTCAGCGCAACGCCGTCATCCAACTACTCGACAATACTGATGGATCCGTCAGAGGCAAACAGAGACTTCCTATCGCGTGCAGTTAA
CTGCGACGCAGGATACGGACTGACAGTCTACCCCATCGATTTTGAGGATAGTATAAGTGCTCTAACATAATGCAACCTTTTCATTTGGTACGGATTTACT
TCGTTACCTTTGAAAAACACTACCAGCGATGTCAGTAAAAGGCAACGAAATGCATATCTGTAATTTTTCGTCTCTTCACTGCTTCCTTACAGTTAATTTA
CATGGCCAACACTGAGATAATTACGATAACTAGCACATATAGGAAATATTTCTGTTGAATGACCATCACTCGTTTCACAAAATTCAGTTAGCAAAATAGC
TGCATTTCTAAAATTTAGAAACGATGTCTGTGGACACCCTGCAAGCTCTAGCAGAGCAACTCTCGCTTGCACTCGCCGCTGCGCAGCGTCATCTCCAGAC
ATCAGCAGTACTCGCTGCGTCCACCGGATCTCCTCGAGACGACGCTGGCGAATTGCACGTCATTTCCGTAGAAATTGAGCGTCTACAGACCGATCTACAG
TCTGCTACAGCGACAATACTGACCCAGATGAGACTCAAGTCTCTATCAGGTGTTACTCCACCATTGCAAGCACGACAAGTCTCCACCAAAGGTGAACATA
TAGAAGACTCTGAGACAGAGACAGAAGACGAAGAATTTGGTTCCGAAAACCAAAATTCGACGCAAAAACGACCTCGAGACGCTGCAAGACACGAAAATGA
ACTCTTGGACAAGAAAAAGAGGAAGCAAGAGCCACCCACTAAGGAAGCAATGAAGGCGAAGCTACTGCGCTTCGTACAAGCTACTGATGGAGCTTGTAGT
TCATTACAGGCAGGTGCAACCAAGTTGAAGAGTTTGTCATCTACTTTTGGTCTCTGCCGCTCCGTGTCCAACAACATTTTACTACTGCTGAATAATGGCG
AGACCATTGACGATGAGATGGCGAATATGTATCGAGACACAACTGGAAAGTTAGCTGCAATCGTGACGGACAAACGTGCGGTTGGACAGATCCCCACGAA
GAGCTTGGACATGGCGATATTACGACTTGGGAATGTACTGGAGCTAGCAGATAAGACAGCAGGGACCCCTGCAGCACTGTCAGACCCTACGCTGCGATCT
ACACGGCTGAAACTGAAGAAATACGCAGATGATCATTGGGATGACATGCTGTTGAATTTGCACGAGTCTGTGCAGTCTGATAAACACCCAGGACGCAATT
CGCTGCCTCGACTTCAAAAGTTTTTGAATGACTTTGGAAAAGAGCTCATTTCATTTATGAACAATCAAGATCTTGGAATGGGGCCACGTTTGGAAGAGCG
GTGGGTAGTCTTTGATGAAGTCGCCAACACTTTGGCAAATTGGATCAAGCTATCTCCTAAAACGTCAAAGCAACCCAAGGAAATCTCAAGTTTTTTCAGG
ACAATGAGGAAGTTTCACGCGAGATTTCCAGATCGGATCCCGCAAAAGCTGTTAAAGTGGGTTGTTGCAACTGTCTTTGTGTTGTCGTTGTCCTCACAGC
TAACTAATGACACATTGCGTTCTGTTTTGTTTCTAGGATTGTTCGAGACCGGAATTATGTTTATCTGTCACAGCAAAAAGAAGAGAAAAAGGCTAAGTCG
TCTTAACAGTATACCACTGACTACAGCAGCTTGATTCACTTCAAAGGGATGACATATTGTGGCTCAATGACGCTTTCCAAAAGATTTTTACTGTTGATAT
CGCATGGTGGAAAGTCGAGATTGCATCGCTGACGCTGTTTGAACTAAATTGGATATGATCGACACATACCTCCCGTGAATGAACTTTTAAGGCACAGTGA
GACCGAGTTGGAGGAACAGAACGTCATGTGAAGAAAATGACGTCTTCGTTCTTGAGGACATGTCCTCAAATGTAAAACCACTAACTGAGATTGTTCAATT
CTCTATATCTTCTTATGTCCGTACTGGGAGGCATGTTTCAATGCACTCATAACTACGATTTCCACGTCAAAGTAACATGTCCAATATGTGGATCTCTCAC
CTGTGGTGGACTACTTTACTTTCAACACACGTGAGGACATGTGGATACAACGTGCCTTTCGCACTGTTATATTTTGAACTGGAGGACACTTATTTGTACC
GCTGTCTTGAGTACTCTGGGTTTGGCACGCTTGCAAAGGATCATCCTGTTATCGCGAATGTGAAACGTATTAATGATTGCAATGCACGGCAGGTGCACGT
TTCTTATGGTTGTTGGTTTGCTTTGGCGTTGTGAGTTGTCGTTTCCCCCTTTACCCCCCGACAATAATGAAGCATGTAAGAACAAGAGTTTGAACATGAC
AATGGTAGGACCAAGTGCATACGATAGAATCCGGTCACGATTGGTTTCTATGAGGTGCCAAACTGTTCACGTGTATTACCAAGTTTAAGGCTGCAGATGA
TTATGCGTGTGAATGGAACGCTATCTTTATCGCTCGCAAATTATTGGAAACAGGGCTTAATCACTTTTATCCGAGCTTCTCTGTACCAAAAGTGGGTACA
TTTTCCAATAAGCAGATTGAAGGAGCTTCAGCGACTTGTGAAGCAGCAAGACGGTTTGCTGTTGGAAAAATCATATAACTTGACGAAAGAAATTGGTTCA
CGGTGCGAAATAGTTCAGTCATACACGAAATCATGAATGCTGTGGTAACTGCAATAGGACGGTCCGAGGGTAGATTATAATTAGTTCTGTGTATTCAGGA
GCTTCAA