Description :
From Genome Similarity Track
Location :
Scaffold_1141:3671- 5249
Transcript NameFunction/comments
Physo_145392predicted protein

Sequence
1578 bases(100 bases per row)
GGGCAGCGGCGCTGCTCCCCCCGCCAACGAGACGGAGGATCTACACGGGGCACTGGTGCTGCCGGGACTGCACGACGCGCACATCCACGTGTCGATGCTG
GGGGAGAGCGCCGAGTGGCTCGATCTGTCGGGCTGCACGTCGTTCGACGAGTTCCAGGCGCGGCTGAGGAGCTACGACGCCCGGTACCCGGACAAGGCGT
GGGTCGTCGGCATCGGCTGGGCGCAGGACGAGCTCTCTAGCAGCGCGCGGTACCCGAGTCGCCGCGACATCGACGCCGTGATCAAGGACCGCCCCGTCAT
CCTGCACCGAGCTTGCTGGCACATTGCAGTGGTGAACACGAAAGCTCTGGAGATCGCAGGCGTGGACTTGACGGCCACGAGTCACAACGTCAAGCACGGA
GCCATTGACGTCGACGAGAAGGGCGCCACGGGCGTCCTGAGAGAAGACGTAATGTGTTCATTGATTAATGCAATTCTTGAAGACTGGGGGAAGACTGAAA
GACCAGTGTTTTTGTTATGAGTGCAGGCCGTGCAGATCATGGAGAAGCATGCGAACGAGCCGTCGCTGGGTGCGTGTCAATGGCGGTGGTTGTGTGTTGA
GAGCTCTAGGTTTGAGTGACTGACTGGTCGTTTCACTGTGGATCGTGCAGATCTTCGAGTCCAGTACTTGAGGAACGCGTTGGCGAGATGCGTGATCTCG
GGTCTAACTGCTGTTCATACAAACGACGAGGACGCGTGGCGAGTGTATGCCAAGCTGCAAGAGGAAGAGGGACTGCCTGTTCGTGTGTACCTGACACCGT
CGATCCACGAACTGGGAAAGCCTACGACGCCGAAGCCTGGTGATTGCAGCGGACTACTGTCGTGCCACCGCATGAAGATTTTCAGCGATGGCAGCCTGGG
AACGGTAAGGCTGAAAACGCACACAAATACGAAGGTGCTCATCTTTTGTCGTTATGTTACCAGGAAACAGCGGCATTGCGCATTCCGTACAAGGGCACGA
GCCACAAGGGAATCCTCATGAATTCAGATGAAGAACTCATTAAAAAGATTGCCGATGCGACCGATGCTGGTTACCGCGTCGAAATCCACGCCATTGGTAC
GCTCTCTTGGGGTTATAGTCTGCAATAATAACTGCATGAAGCATTTATCTGACGAAACACTACACTTCAGGTGATCGCGCTGCAGAGCAAGTTCTGACAG
CCCTCAGGGCCGCCAATGTTGGGCCGGAGAAACGCCCCATTCTCACGCACTGCCAGATCCTTGGTGAAGATCTGATCTCCCAGATGCGTCATCAAGGCGT
TATCGGCGACATCCAGCCATCCTTCACTGTGACGGACGCCGCTTATGTGCGCAAGCGCTTGGAAGACGACGTCATTCCCTTTTCATACTGTTGGAAGCGG
ATGCTGGAGAACGACGTCGTGTGCGCAGGAGGAAGCGATGCGCCCATCGAGACGTGCAATCCGTTTCAAGGCATCTACGACGCCATCTACCGCTACAAGC
CCAACCAGCCCCAGGACGTATTTTTGCCAGAAGAGCAGCTCTCATTTGACCAAGCTCTGGCGCTGTACACTAAGGGTG