Description :
From Genome Similarity Track
Location :
Scaffold_2456:3670- 4967
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2456-snap-gene-0.1Adherance factor

Sequence
1297 bases(100 bases per row)
GAGATGAGCGTGCGCGAGATGGAGATGCTCACAAGTGTGGCCAAGAGCATGACCGAGTCGCTGCTCGAGGCCACGGACCTGCTTGGCGGCATCCCATGGT
GCCTCGTGCACGAGAAGCACGGCATCTCGCTCTTTCGTGCCGACGTAGGCAACAACGCGCCCTGCAACGTGCACGCCGTGTGCAAGGTCACGTGCGAGAT
CGAGGACGTCGCCGAGTCCATGATCACGAGCTCGACCGAGTCGTACACCAAGATGATGGAGCTGCTCTCGTCCGACTTCATCGAGGGCGCTGTGATCCAG
AACATTGTCGAGCCGACCGAGCTCAACCCGCATCGGTACGTCGCGCTCAAGTGGGCCGCGTTCAAGAGCTCGAGCAAGTTCACCAAGGACCGGGACTTCA
TCATCCTCGAGTACGTCGACATGATCGAGGACGACCAGGGCCAGAAGATCGCGTTCCGCATCATGGAGTCCGTCGACGTGTCCAAGACGTCGGCCTACGC
TGAGTCGCCGCGGTACACGCGCGACATTGTGCCGCTCATGGGCTTCATGTACCACACGACCAAGAAGCCGGGCGAGCTGCGCATGACATACACGTGCAAC
TTTGACAACGGCGACCTGCCGGCGTGGGCGGCCAACTCGGCGATCCAGTCGCACGTCGAGAAGTGCATCAACGGCATCCTCAAGTACATCGAGACGTTCT
GCGTGCAGAAGGAAACAATCGTGCTCCCGCAGCAGGTTATGTCCATGTGCGAGCAGGACCACTGCAAGGTCTGCGAGCGCAACTTCTGCGTGCTGCGGCG
CCGGTACAACTGCCTCAAGTGCGGCGAGGTGATCTGCAGCAGCTGCAGCACGATCCGGAGCGCGCTCGTGCCGGACCACGGCGAACGCCAGCTGCGCGTC
TGCACGGCCTGTGTGCTCGAGGTGCGCCGCACGTCGCGGTTTGCGATCGACTCGCCCCACTCGGTCCACTCGGCACCGACATCCCAGGTGCGGTCCCCGA
CGTCCCCACACCAGCCGGGCCCAATCGTGCGCACACAGAGCTTCTCGAACGGCAAGCGCCGGTCCTACGACGACCTGCTCGAACCCGTGCGCAACCGCCT
GATCGAGCACAAGACGTTCTCGTCAAACCCCGAGATGGTCGAGATCCCCAAGGCGAGCTTTCCGCTGCGATCGCTCAGCGACGGCTTCGTCATGCGCAAG
GGCAACTTCTTCACGTCACGCCGGCGCGGCAGCCCCGCTGACCTGGCCATCTCCATCGAGGCCTTCCGCCACCACCAGATGCGCATGGGCGCCGGCG