Description :
From Genome Similarity Track
Location :
Scaffold_1880:367- 2310
Sequence
1943 bases(100 bases per row)
TCTGGAGATTTGGCTGATTGCAGTTGATGAGACCCTGGGCTTGCTGGATGGCAATCCTGGAGTCCCCAACCACAACGATGTCCTGAATTCCACGCTCAAT
CGCTAGAGTGAGGCCCTTCAGAAGTCCATGATACTCAGCGTCATTCACAGTCACGTCCTCCAGGATGCATCCCTGGGCATCCAGGATTTCCCAACCAGGG
ACATGCCACAGAATGCAGCCACAGCTCCCTTGTCGCGTGGAAGTCTTAGCAGCGCCATCGAAGCTCAGAATACACCCCTCGTAGTCCGCTTCCATCATTT
CCATACTGATAGGCACTGGAGGGTTTAACGCGCCCCTTAGCTGGGATCAGGTTTTCAGCGATCTCATCCAAGTGTTCTCTGGGGGTAATACCCGCACCCA
GAATTGCAGCCAAGCCGTCTTCATCCCGTTGAACTCTGCGTATCTCCAGGTTCCAGTGGGACAACTTCAGACCCCACTTCACCGTTCGACCGTCTGCCGA
CTGCGAGGTCAGCAACCACTTCAACACAGAATATCGCGTGTAGACGACGAGCTTAGGGCTGCCTTCAACCAAAGTGCGAAACACCTCCAGGACTCTCAGG
ATAGCAATCACCTCCTTTTCTGCAATGTGATACCGCAGCTCAGCGTCATTCAAGAAGCGACCTGTGAATCGAACCGGGTGCACAATCCCGTCGTTCTCCT
GGCCCAACACAGCGGATGCTGCCCACGGGTTCGCGTGGGGAGTAATCACGAAGGGCCTTGAACGATCTGGATGTCTGAGCAACGGAGTCGAAACGATCTT
GCGCTTCAGGATTTCAAAAGCTTCCTGGGCTCTCGACAGGTCTCTCCTGGATTTCACTTGTTCCTCAGTCAGCTCGTCGTCGGGAACGGCAAGTCTTGGA
CCCCCTTCGCGATTTTAGGGGTCGCTAGGATGCCCTCAGCACTAATCTCGTGAGAGAGGTACGGAATGGACAACTTCCCGAATTCGCTATTGGGAAGACT
CACAGAGATATTCCAGTAACGTAGTCGGAAAAGCAGCGCGTTCAGATCCTGGCACAGCTGCTCCCAAGTAGGCGCACCGTGGGCGATGTCGTCGATATAC
GAGCTTCGACCCAGGACAGGGCCCATCTGAGAGGGAGCCGGGATGTTACGCTGAAAAACAGTCATCTCATCCATCAACACTGAAAGTCGCGGTGCATTTT
CACCTGAAACTCTGGGTTCCCCAGGGTTCAACCCCAAAAAGTACAAGACATCTTGGTCGACCTCAGCTTCTTCCTCAGGGGGAAGCCGCAGAAAACCCCA
CAGACAGTTATTGAGAACTGCCTGGTAGATCAGCGGCGCGTTCTTGAGGCCAAACGGCATCCTTACCCACTGGTAGTGCCCATAGGGACAGACGAACGCA
GAGATCAACTTGGCTCTCTCGGTCATCTTGATAGCCCAGAAACCACTCGCCATGCCCAAGCTCATAAACCACATCGCCGACTCAAAGCCAATCAAAAGAT
CATCAATAAGCGGCAGCGGATAGTGTGAGAGCTTGATGAAGCCATTCACCACGCGATAGTCGATGCACATCCGGATGTCGACGCCATTCTTCTTGAGGAT
GATCACGATTGGAGATGCCCAGGGGGACGTAGAAGTCTCGATCAGCCCGTTCTCCAGAAGCTTCTTCAGAAGTTTATACACCTTAGTCCACAGGTGTGGT
GCAATGGACCTTGGACGCTGGGCAACAGGTTTAGCGTCGCCTACATCCAGGTCACAAACCACTCCACGAGCAGGTGGGGGAGCTGCATTGCCGTCTCCCA
AGAAGATCTTCCGATGATACTCCAGAATTCGCCTCACTTGGTCTTCCATCTCGGGCGTCGTTTTCCCAGGGACTCCAACATCTGCCTCCTCGATCTTGCA
CTCAGGGGTCAAGTCACGCATCTCAGGAAGCATAACCAACTGG