Description :
From Genome Similarity Track
Location :
Scaffold_4:366907- 373918
Transcript NameFunction/comments
Physo_128224hypothetical protein

Sequence
7011 bases(100 bases per row)
ATGCAGGGTGAAACCAACAAACGGGAGCTAAAAGAAGACGGCGCAGGGGTGTGATGTACACGTACTAGTATAGTAGTTAGTACTTCTTCGAAATGGAGGT
AATCTTGATAAATATTGAGCCGATTCCGGTAGACACATTCCTCATCCAGTGGAATCACTCCCCTCGTTAACAGCTTCGGCATTAAAGTGTTACGGGTGTG
AAACGCTCACTTGGATGCAATCTGCTCCAAGCGCTTGACTTTTCCATCTAGATACAGCAACATGTCGTCTTTTGCGTCCAACGCGTCTTTCAGTTTCATC
ACGATTTTCCTGCAACATTTATCGTTAGTCAAGCTTAGGCTTTAAGACGGGGTAAGGTCAGCTCGTACCTTAATTGCGCAACTTCGTTGAGTGAGCTCGC
CTTTTGAGCCTTTTCCGGATGCACTTCGGGGTGCTGCTTCAAAATTGTAGTCTCGGCGTCCTTGTCGTTGGAGCTTGGGCGTTCTGTCCATGGTTTAACT
TGAGGCGAGGCCTCGCACACAACCAACAACTCGTTGGTTAGAGCACTCAGATCTGTCAGTGTCTTCAGCAGCGAAGACCGTTCAGCGTAGTCTTCGTCTT
GAGCTTTCTGGGGATCCTTAGGATGCATTCCTGTCGTCGTTTGGTTACTGGATACCATTTCGTCAAACCATGCATCAAGGCTGCTCAATTGCCCCTTCAC
GGTCTCAGGTGTTGCAGGGTGGTGTTGGTCATTCGTGAGCCGAGAAGACTCCCCATCAGCCTGCTGCATGTTGCACAGTTCCTGCGCCACAACAAGACCG
TGCTTTAAATGTTCACTGGAGATTCGTAGCAGCACGCATTGCGTTTCGGCTCGTATCCACCGCTGACTGCAAGCTTTGAGGTCGATTCGGCACTCTTGCA
GTTGCTCCGCAAACTTGGATGCGAGTTGTTCAAGTGCTTTGTTCTGGCTCTGAGCTTCCCTGGTTCGATTAATTTCTTCTCTCAACTCGCTCGAAAGGGT
CTCCATTTGTGCCTTGAGATCTTGGATTGTGCTGCAGTAGTTCATCTTGATCGAATGCTGCCGGTTCTGTGACTTGTTGAAAGTGTATGCTTGACGTTGC
AAAGTCTCATGTGTGGCCATGCATGCCAGGCGTTCGACTTCCAGTTGCCTCTCCAACCTTGCCAATTGTTCAGCCAATATCTGGTGTGCAGTCTCTAGCT
GTAACGCAGATTCTTCCATTGATCGGCATCGAAGCACTTCATCGTCGCGCTCAAGCTCCAACTGCTGGCATTTCCCCCAAATTTCCGCCAGCTCCAGCTT
CAGGTGTTCGATGGTAGTGCTCTGCATCGATGAGTGGTCAAGTAGTTCAGCCAGTTCCTCACGCAAACACGCCACTTCTATCGTTGATTCGTGCAGCTCT
GCTCGCACACAGTTGACTTCTTCCAGATCGCGTGCAGATGCGGCATCGAGTTGACTTCGTAACGCGTTTTCACGTTCCAGCGCGTTCGCGAGAGCTTCTT
CGGTTTGGCTAAGTAACAAGACATATTCATCTCTCTCTTGCACTGCCGCTGCGAGCATCATTTCCAATTCCTGTTGAGACTGGTTGTCAAGGCTTATCCG
TCTTTCCAATTGAGCTATTTGGTTTGCTTGGATCGATACGTAGTTCCTGGCCGTAAAATGTGCAGCGGCAGCATCCTCTGTACACATATTGGCTATTTCC
TCTCGCATCCTCAAGCTTGCCTTCAGATCTTCAATTGCTGTGATGTGGATCATGCATTCACCTTTAAGTTGAGCTGCTCTCTCCAGCGCAGCCCGTAACT
CCAACTTAGATTCGACCAGCTCAGCTGACAATTCAGCATTCATTGCCTGAACGTCGGTGAGGGAGGCATTCGTTGCTAGCCACCTTTGCTCGTGCTTAGC
CGACTCAGCTGTAACCATTTCCTTGGCTTCCTTCTCGGCATCAGCAAGCTGATGCTTCAAATCTGCTAGCAAAACCCTCGACTGCTCCTCCAGCAGTTCC
AAGTCCGAGTTCGTCTTTTTCCGTGCTACTTTCTCGTCTGAGAGCTCAGCCTGAATACTTTCTAGTTCAGAGATTTGCTCCGAATTGACATGTTGCAGCG
TATTTAGTTGACTTTCAAGCTCGCGAGCGTTGCTATGGGCATAGTCAAGCTCCTTCTGCAACATGGATACACGGTCATTCAATACCTCCATCGCGGCTAC
ACTGTTTTCTGAGCTGTTGGCATTATACGTTGACGAGAGGCCACAATTGAGACGACTGTTTTCTGCCTCGAGCGCGGTTACCCGTGCGGAAGCAGCGGCC
AGCGCGCGGTTCAACATCGCAAATCGGCACAGCAACTCGTCATTCCGTGCCTGAACATCACGAGTTCGCGCGACTTCCACGGCTAACTTTGATCCAAGGT
TGTCCCCACTCTTCAACACCGTCATTGCATCGCATTCCTTTTCGAGTTGTTTCAGCGTGATTGTCGAGTGATTTGGTATTCGATTCGGTACTTCCAGTCT
ACTACCGGTTGCCACGAGTGCCTTACACCTTGCGGACAACTCCGCATTGCGCTCTTCCAGCGCCGCAATCTTAGCCGAAAGTTTTCGGTCTTTGATCGCT
GCCGCTTCTTGTGCGCGCATTTGTAGCAACCGCTCGCACTTCCGGTGTCCGGTAAAATTCCACACGAGTTTAATTCTCTCCGTCATCACGAGCAACTCCG
TCGCCACATTAAAAGCAGCGTTATTCTCACTAAACTTTATCATACTATCTCCACCACGAGTCAATTCAGGCAAAAGCTGCCTGAGACGATCACTGAAATG
CTCCAACTGCGTTTCAAGCTGAAGACGACCGGCTACACACGCGCTGGCGGCGCTAGGAAGCTGATCGCAGAGTTTGGCGATAATCTGCAAACAAAACTCA
CCCACCATTGGCTCCAGCAGTTCATAGCAAGATTGAGACGAGGTGGGTGAAAGTGACCCCATCGCATCTTCGAAACTCCGCGTCATTGCGATAAACTTTT
TATCGAGATGTTGCAAAAGTTCACACTCGACTCCAGTCCCACCAGCGATTCCTTTGCAGTCACGCAAACTGTGAACACCAGGGCCTAACGCACGCCGGGC
CATATCAATAGAATCCACACAAAGTGACAGTGTTGACTGCATATAACTCTCCCCACTGCGAGACTCTGGGGATAACAATGGTGAAGCACTGCTGTCATCT
CTCAGGGTCGTATAGTCTTCGTCCACACCCGTAATCTCGGTAGGCAAATTAAATTCCTCTCCATCGCCACTACACCAACTTTGTGGCGAGGCCAATTCCT
CCAGCTGATGGTAGTTTTCGCTGCAGTCTTCGCTACTATCGCAGCGAAATTCAGAGCGATCGAACTCGGAGCTTGACGCCAAAAGTTCCAAGAGGGACGC
AGTGGATGCGACGGTCGAAGGTTGGAGCTTCGGAGAATCAGGGAGTTGGTCAGGGAACAAGAATTCCTGCACCACCGAGCAACAGATTGCGTCGGCAGCG
ACCACGGCCGCTACAACGTCCTGGGCGCGGTCGCCAACTCTTCGTTCAGCCGTTGGTGCACGGTTGTGCAGTGGAGGGCACCCTGCTTTTCTGCCGCGTG
ACTTTAGTGGTGAGAGTTTGCAGCAGCTTTGACCTTCCAGTCCACAGGGCACTGACTTGAGCTTAAGATCACCCGTAGTACTTCCATGTAAGGACGCATA
TTTCCTCCACCGATTCCAGGCACGATACTTGCACAGTGTTTGAATCCGGCGCCGAATAGCGACTAGATTCAGCAAGCAAACGCCCTTTTGCAGTTCGAGC
TCAGTAATTTGTTTCTCTCGCGTAGAATTGACCTGCTTCTCGACCTCAGCGTGGCTTTCTTGCTCACAAACCACAGCTTTTTGTTCCAAGTCCTGCTCGA
TCGTACCCGCAAATTCGTCGTTACTCGTGCACTGCTCACCACAATTGCAATCCAGGCACTCTTCAAGATTCTCTGGAGCTCCACAGCATACAGACGAAAC
ATGATTAGATGAATTCAACACGGTGAGGGTGGACTTGAGCTCGCTCGCATCATCCATCAGTTGCTGTGTCATATCTCCACAGATCTCAGGTATTCGAACT
GTGCTGTACACACTCCTCGCGCGCTCAATGTATCGTAGTGTGGTCATTGACTCTTCATAGTGCGCGCAGCACGGACTAATGGTCCCGAGTATGATAGTCT
TCGCGTGTCCACCGAGACAATCTTTCAGTAACCGCGTCAAGACCGAGTTCCGATAAGGCGCGAATACTTTCTGACGATGAGAGCCATCGACAGAGCGACC
ACTTCTCCGCTTCGCTAAAGCACCGACAACATCCGCGAGAGTGGCCAACGAACGGTTGACACTTGCAGCCTCTCGTGCACGCAAACCGCTAACATCAGAC
CGATCCACCCGCTCACTTGCTGCTAAATCCACCACGGCGAGCTTGCTCTTCCGAGGGGACGAGACCGCCGGACTGTTCTGTGATAGTGAAAGCAACAGCA
CCGTGTGAGAACGACTAGGGCGCGAGGATGATACCGAACGCGTGCGATTCCCCTCTTCGATCAGCTCTACGACTTGCGAGCTGCTCGTGACTTGCACACG
TCTCGCTCGCTCAACAAAAGCTCCGTCATCTGGGTGTTCTCGAACTTTTAGAGATTTCTACAGCGTCAAACGACAACGTCAGTAAAATTGACGTGAAAAT
ATTATCTGGAACAGACTCAACTTTACCTTCATGGTGCTTTGAGACAGCAAGTCATAGACGCGTTCGTCGTAAATTTCAACGTAGCTCATGATCACAGTGT
ATGAGTTCCCCGACCTCTTCCCTTCATCGATTTCAGCAAACAATCCCTGAAAAATTCGTGGAATCAAACCTCGTCGCTCTGACAGTGACAACGCACTAGG
TGGAGCCCGTACACCATTAACGTTGCCGTTGGTCTTGACAGACGCAGGTAAAGAGGCTCGCTCGCCACTACTCCCCATGAGGGAATACGTCTTACCAGCG
CTGGGTTGTCCATAGGCGAAGACGGAGCAGTTGTTACCTTGAAGTACTTGTTGCAGTGCCAGAACGCCCAGTTCATCGTAGATCGTGCTCTGCGTCGCTA
CGGGGTGTCCAGGAGAACGATCAAAGGACCAATACGTGTAGTCGAACCGAAATTCCTGCGTAAATTGGGCTGGGAAGGTTGGCGAGTCCGTAGTTGACGT
GGACTCCTCCAGTGGAAGCTTACTTGACGTGTACCTTGCCGACGCGTGGCCTCGAGGTGGAGGCGGGAGTGCTGTCGGGTTCACAATTCTGGTCATCAGT
CCGTCGGTAGTCACGGTCATGTCGATAATCGCTCGATAGCCATTCTTCTTCTCCGAAAGCAGCATTGGTCGCACGCACACTGCAGTAAAAGTGCGCTGGT
CTTCACTGCATGCAAAGCTGCTACTGTCGCTAGATCCAAGACTCGAAGTTTCAGCGGCCAGTTCATTGAAATCTCCGTCGTCCTCGTCAGCGAGGAGGAG
TTCGCTGTCGTCTTGGTTATCATCATCGCCGCCTTCACAGTCGTGCATTGGCTCTTCATTTAACGCGAAATCACGGGCTTCGTCGAGATTGCTGGCGGAA
AGGCGATGCCTCTCCTTTGGTTCACGACGGCAGCTACTAGCATCGCAGTGTTCGTCCATGATGCAGCACGTACGAAGGTGTAGCGCGCGTCAAAATGGGC
TCCACAGCTTCGCATGCCAAATACTTGTTACCGTGTGCATGTCTTCAACCAAAGAAACCGCTCAGCCTCCCCGACAGAAATACCACGATTGAGACCGCAA
GCAGAAGAAATACACAGAGCATCCAGATAACCTGGATATTTTTTTACTCAACGCGAAAACTCAAGGTATGTATATGCCACAGCGAGCTCATACAGCTTCC
GAGGGGCCACGCTGGTTCCCGAGCACCTTGTCACTCGAAGTCGTGGCAGATTCATCTCCGGATCTGCCATCGGCGCTGGCTGACGTCGTGCGGCTCGTTT
CGGTCGACATGTGCTCGACGCGTGGTGTCAAGTAGAAAGAGGCACCGGGAGGCAAACTGGTGATCGTGGCGATAGCGTTGGCAGCCGCTTTGCCGAGCGC
TTCACTCTGACCCGCTGCAGCTTGTTCAACAGAGAGTGAGGTGATGGGGGCGATGGCATGAGCTTGAGCGGCTTCCTCCGCAATTCGGTCTGAGAATGCA
TCAAAGGTACGAGTTAGCTCTGCATACATAATTACGTTTCCATCGGACAGTTCCATCGGACAGCACGCACCCTGGTGCCACTTGGCTTGCAAGTGCGCGA
CCATCTCCGAGACATCCTGGAGTCGCTTGTGAATCACGCGCGACGGCGTGTTCTTCAGCTCGTCAAGCAGCGGCTGCATCTCCGACGCTGCCATGTTCAT
CTTGTGATCGTTCGCCAGCGCCTCCTTCATCAGCAAGCCAGGAACGGGAACGCTCGCTGAAGACGCCGTCGTCGTGCCGACCGTCGTCTTGGCACTCACT
TTCGACTCGGGCGAGGACCTCATCGTGAATCCTGTCACCACCGGCCAACGTTAGCATCAGCAATAAGAAACACCTCTATCCGCAACGCAAACACTCACCG
GGGTCGCCATTCCCCATCGGGTCCAGCTCCGTGAGGATCCGCGTCGACGGCTCATAAGCTGCAAAACCCCAGTCAATCTGTCAGTAAACACCAACTCTAC
CTCACACACCCCTCCTCGTGTATCACCGTACCCGACTCCTCGACAGCGACTTGGTGCGTCTCCTGCTTGTGCTGCAATTCCGCAGCCTCCGACCCCAGCA
GCAGCTCGTCCGGCACGGAGGTGTTGTTCGTGTAGCAGTGGTAGATCTCGTCGCTGATGCGGTGGTTGTGCACCGTAATCTACAATCGTACAGTACACCG
TCAATCCCCTCCCACCTTTCTCCGCTCTACCTCCACTCTACGCCCGCCCTACCTGGTTGCGCACGCGGATGAGCCAGCGGATCTTGCCGGGCTCGCCGTC
CACCGCCTCGT