Description :
From Genome Similarity Track
Location :
Scaffold_1:3668575- 3675141
Sequence
6566 bases(100 bases per row)
TTCGGGCGCTGCTGTTAACAGCAGCGCTCGCATTACGTTCCACTGTGCAGCGCATGGTGGGCTTCGTACGCCCTCACCATGTCCGGGACGTCTTCGACCA
AGACGTCCCGCGGCTACCATGTATCTTGGTTGGGAGGGAATCCTCTCCAACGGATACGAAAACGAACTGTTCGTTCTCGGGATACTGTGATCAACAATCC
ATCGAGTTGAGCCGTGTGCATCACGAATCGGCGGCGGCGGTGGCGGAAACACCCCCCGTGTGTGGTCAACTTGGTGTTGACCCTGATCTCGAGTCTCCCC
ACGACCAAGTCCCGGTCGTGGAGTAGTTCCAGAGCGCTACGTTCGGCGCTCTGAAGTATTCGCAGTTTGCGGCGGCCTCCCAGGCTGCCTCGATCGTTCC
GGCCGAGCTAGACCATTAGCTCGACCCGCTGCTCCAGCGCGACTTCGCGCTGGAGAGGACGATGGCTTCCGCCGAGTCTTCTGCTTCGGTTCAGCCGAGC
TAGGTAGCTCGTGCTGCAGGTATGGCTTCAGCCTTCCGACGTAGAACGTTGGATGGAGACGCATGCTAGACGGAATCTCTAGCGTGTAAGCATTGCCATG
CCGTGCCAATACTGTGAATGGCCCGACGACGCGCGGAGCGAGCTTGCTCGCCCCGAAGTCGGAAACTGCATGTTTAGCCAGGTTTCGCGTAGCTAACAAA
ACCAATGAACCCTTCTTGAATTCATTTGTGTTGCCCCTGCCAACATTGTCTGCGTTCAGCTTCTGTCGGTCGACAGAAGCTGCGATAGCGTCCTGGACAA
ACCGAATGACGGCTTGTCTGCGCTTTACGAAGTGAATTGCGTCAGAGCTGAACTCGTTCAGCTCGCATCCAGCAGTAGGCCCTGCCTCTGCGTTGGTCTT
CGTGGTGTCTGTGCCCTGCACAGACAGGTTTTTCTTCTTGTTGGTGTCTGTGTCCCGCACAGACAGGTTTTTCTTCTTGTTGGTGTCTGTGCCCCGCACA
GACACGTTCTTCGTGCGCTTGTCGGCGTCTGTGCCCTGCACAGACGCGCCGTTCTTGGCTTTACTTCGTGTCGTTGCGGCTGACACTGTGCAAGTGTCAG
CGGCATTCTGCGGCTGCTGCGGTGCAGTCGGAGATCCTCCCCCACTTAAGGAAGGAGCCACCATCCCGAGTAGACTCGGGAGGCGTGGGTGCCTCATGGC
ATTCACGTAGAAGGGTGTATGCCCGGTCGAGGCATGCACCGAGTTGTTGACGGCGAACTCCGCCATCGGCAGGCACTCGCTCCAGTGTTGGAACGAGTGA
GCGTAGCTCTTAAACACGTCTACGAGCACGCGGTTCACGCGCTCGGTCTGCCCGTCCGTCTGCGGATGGTCCGCAGTCGACATCGAAAGTTGACTCCCAA
GAAGTGTAAACACTTCTTGCCAAAGGTGCGCAGTGAAGCGCGGGTCTTGATCCGACACAATGTCGATCGGCATGCCATGGTGTTTAAACACCATGTCGAC
GAACAGACGTGCCGTCTGCTTCGCAGTCACTTCAGCGGGTACCGCACCAAGATGTACCATATAACAAAGACCACAACGCCCGTGTTCCCCTGACTGTCCG
GTGGAAGACCGAACACGAAGTCCAAAGACATGGACTGCCAACACTCTCGTGGAGTTGGTAGTGACCGCAAGGGAGCCTGCGCGAAAGGCGCAGGCTTCAC
ACGTTGACAAACCTCGCAAGCACGGACGTACTTGCGCACCCATTTGTACTGGTGGGCCCAGTAGAAGTCTCGCGTGAGAAGAAGGTATGTCTTCTCACGG
CCCGGATGCCCCGCAGTCGGTGCATCGTGATACTCGTACATGATCCTGAGTCGCAGGTCATGGTCATTGGGCACGACAACGCGGGCCGCGTTGTCGTCGA
CTGCACTGTAGAGTAATAATCCGTCGTGCGCCCGGTAACGGTGTGTACGAGCACGAAGATGCTTCGGCAGCTTCTGACGAGCTTGGTCAGAAGGCGCTGA
GCCGTAGGCCAGCAAGAGCTTCGCGTCCGCGTCGTGCGCGTAGCGACCTTCACGTCGTCCAACAGTGACGACGTTGGGGTGCTCGATCGCATGGCGTCAA
TGGCATTGACGTCGGCATCAGTCGTGGCGTAGTCAGGTCGACGCGAGAGCGCGTCGGTCACCTCATTGAGTCTTCCGGGTTTGTACTCAACCCGGAAGTT
ATACTCTGGGAAGAATGAGAGCCATCTCGCCATCCGTTGCGAGATGTGCGGCGACTTCACAGCCGTCCGCAGCGACGCGTGGTCTGTGTAGACCACGAAC
GGTTTGCTTCCGAGTAGATACACTCGGAACTTCGCGAGTGCGTACTTCATGGCAAGGAGCGCCTTGTCATGTACGGGGTAGTTGCGCTCAGTTGGCTTCA
GCTGGCGCGATTGGTAGTAGACGACACGATCACGACCCTCGTGATGGCGCTGCATCAACGCACATCCGATTGCGAAGTCGGATGCGTCACACACAACGTG
GAACGGGCGATCTTGGTCGGCCACCGCCACGATCGGCGCCTCAGTCAAGCCCTGCTTGACTGCATCGAAGGCCTGCTGACTCTCAGCAGTCCAAACCCAC
TCGACGTCCTTCTTCAGGAGCTGTGACAGCGGGCGTATCATGCCCGCGTAGTCCTTCACGTACTTGCACAAGTACGTGGCGAAGCCAAGGAACTGCCGCA
GTTCCTTGACGTTCGACGGCGTCGGCCACTCATTAATCACTCTGACCTTTTCAGGGTCAGGGTGGACACCGTTCTTCCCAACGAGACACCGGAGCACGGG
TATCTCGCTCGCCCCGAAGATGCATTTCTTCAGGTTTGCATAGAGCTTGTGCTTGCGCATGAACGCAAGCAGCTTCCGGAGATGCACCTTGTGCATCTCA
ACGTCGCTCATCCCGTCCGCAGCTCGGATGTGGACGAACACATCGTCGAAGTAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTCACGCACC
TTTTGAAGGTCGCAGGGGCTCTTCAGACCCTGCGGCATCACTAGCCACCCCCGAGCATGCGGCTCGGCGTGCTCACGGCCGTGAGAGGGATATCGCTCTC
ACGCATGAGGATCTGATAGAATCCATCGCGCAGATCAAGAGCTTTTACTGTAGATAGTGCTCCTGGCCATCGAATCGATGATGACATCTTTTCGCGGTAT
CGGTGTTTGCGCCGGTATCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCAACCGCCCTGTGGCTTCTTGACACAGAACGTCGGAGCACTG
TGCGGGGATTTCGATTCCCGCACTTGTCCAGCTTTGCGACGACTCTCAAAAAAGTCGTCGATCGCCTTGACCTGCTCTCGCGGCAGTGGCCACTGCCGCG
TGACACAGTACTTCGTCCCCGGAACGAGATCAATCTCGTGCTGGATGCCCTTATCCTGCGGAAGCTCCGCAGGAATCTCTTCCGGAAGTACGTCCACGTA
CTCCCGTACGATCTCGTACTAGGGACTCGTTTTCAACGAGTCCCAGCTCTGCTCTTCAAAGCGCTCCTTCTTCGTCTTCACACTGAGAGTGTCCTCGCTC
TCAATGGTGGTCTCCATGAAGAACTGCCTCAGTTCTTCATTCTCGCTCTTCGTTCTCTCGGCGTCCGAGAGAATGCATATTTGCTCGATGCGTCCATCGT
GCAAGTCACGCGCGAAGTGCTTCCAGCTCATGACTGGAAGCAAAGTCAACTCCGACGCTTGCGTCGGAGGGTTAGCGAGAGTCATCTCCCTGTACCGGAA
CCCGGCACAGGTACGCGTCAAGACGTTCAACGTCTTAACGTCCGGCTTCTCAGCCTCCGTCTGCCCGGCAGACATTCCTTGTAGCGTCTCGGCCCCAGGC
CGAGACTTGCGCAGCGACCTTCGCATGCAACGTCTTCTTGTTTTGCGGAGCCCGGCTCCGCTTGGTTCTTGACCTCGTCCAGGCCCAGCCGTGGACGGGT
GTTCTTCTTTAGTACCGCCGGCGGGTTCATCCCGCGGGCGACCGACTTCAAGCCCGGCTTGGTCGCCCGGCGCTTCGTCGTGCAGCCCGGCTGCACGACA
GCATGCAAGTTTTTCCGGTGCGGGACGTTTGCAACAGTCCGCACCGCCTGCAGCGTCGGCTCCCGCAGCCGACAAGCAATCTTCACCTCGACGCCAACCA
TCGGCGGAGACCCTCATTACGGAGGGTGCGTCGGCTCCCCGAGCCGACGAATCAAATTCACCCAAGCCATCGACTCCCGGAGTCGACGGCGTTACGTCAC
CTTGGCTCTTATTATTGGCCAGACCTGATCCAATCAGATTCGCGTCAGCCTCCACAGCTGAGGCGTGTGACTCGTCTGCGTCATCCGTGCCCCTTGAGGT
CGGAGACTCTTCCTGATTCGCTGAAAAGCGGGTGTCGATCTCCGAGATCAACACATTTTCTCCTTCAGCCGTCGGCGGCGACGCCGACGCTTGCTGCTCT
TGCGCGCGTGCTCGCGCGCGCCCAGGGCGTTCCGGGACAGCGGCATTAGGCGCTGTCTCGAGTGGGGAGTCGCGCGCACCTGTCGGTGTGTGCGTAGCGG
CAACAGAGCCATCGCTCACTATTCCGCGGTCGCGACCGAAGCACACGAGAGTGCGCTTCTCCCAATCGATGACCGGATCATGTCGTGCAAGCCACGGCAT
GCCCAATACAATGTCAAACTTATCGTCCAGATCCAGGACGATAAAGGTCTCGACAAACTCTTGATCTTCATACGTGAAGCGCACGCGTACCATACGCTTC
TCGGTCTTTACGATGGCACCCGTTGCCAGTCGTACTTCCAACATACTTCGAGGTACCTTTAAATCCTCGAAGTTAAGCCTTGATAGACTTCGCAGTCGAA
CAAAGTTCTTCGACGCGCCAGAATCTACCAGAGCCGCTTGCTCTCATCGAGTTCACGTTCAGGATGACAAGGTCAGGCTTGTCATCTTGGTTCTTGCAGT
GAGAATGAACCTCACTGGGGACTGCAGTCCTCAGTGTCGCGTGTCCAAGGTCGACACGCGGAACTGCATTACCCGTAGGGCGCCCCGCGCCTACTGGCGT
CCAGCGTTTTTTGTTTGGTTGCGACGGTGCCCGGCACCGCCGCGATAGCCACCCTGCTGGTGCAAGGGGCCATGCACTCCCGAGCAAAGTGACCGATTCT
ACCGCATCGGTAGCATCGCACATTGTTTCCTTGCGACTGTTGGGGTCCAGCAGTTGCAGCACTCGAGAGGTCCATGGGTTCTGGGCCTCCCGTCCTCACT
ACTGGGCGTGGCTGTGGCCTCGGCACATGTGCATGCAGCTTAGCCTGCCGCAGGCTAAACTCCTCCTGCATTGCAAGAGTAATTGCAGCTTCGAGAGTAC
TCGGGTACTCACGGAAGAGATAGGTCTTCACAGGCCCATCTCTCAGCCCCTTCATGAACGTGACGACCTTGGTCGCCTCGTCGATCGGATTGGTCACGAT
GTTCGAGACCAAGTACCGTGCTCTCTGAGCGTAAGCATGGACATCATGCTTGCCCTGCTGCAGGTCGAGGAACTCCGCCCTCGACCGCAACTCGTTTTGC
GGGGGCTCAAACGCTTGTCTGAGCTCTTCCTTGAAACCCTCGTACGTGCTAAAGCACGTAGGATCCGAGAGTCGGCGTCCATACGCCCAACTTCTTGCAC
GTCCGCCAAGACATGACATGGCGAACGCGACCTTCGACAACGGGTCGACGATGCGTCGAGCCGCAATGGCAGTGTCGAGTTCGACAAGCCAACGGAGGAG
AGGCTCGCCCTCTCTTCCAACGTAATTGCTCACGCTGATCTTCAGCGATTGCGCGCGCGGTGTTGTCCCCGACGACACCGTGGTAGACGAAGCAGCATCT
CGCTGCTCCCTCATGATGAATCCCAGAGCAACACCGTGTTGCTCTGTCGGCGTTAGCGTACGCAGCATCGTAGCTACAGCCGCCTCACCAATGACCTGTG
ACAGTCGTTGGAGAGCTTCCCACTCTGGGTCCGACAGGTGGGGACAGTCAGCGCGTGCAACGTGAGTTGCAGGCATAGTGGAGCTTTCCATGGACACCTC
CGTATCCATGGGAAGGTTCTCAGCTCCGCGTTCGTGCGGTGACGTACGTACTCAGGTAGTCGGTCGTTGGACGGACTACAAATGCTACCAGGTGTAATGG
GCCTATCTTGGCTCACTACTACGGCTTACACGTATGGGCACGTGTATGAGGAAGCGTAGGTTTCTTTTACTTGAGTTAAGTATACTCGAGATCCACGAGT
ATACTTTAAACAAGATAAAGACTCCAAGTAGCGTGTTTTGGTAAAGGATGAGAACTGCTATTTGTGTTTTATGTTTCTGACTTCCTATAAATATAATATT
CTAAACTAGGAATCTGCCAACGGCTGGAGGGCAGAATTCCAATGCTATGCATGTCACTCATTGGCTAAAAGATGCTGCTCTCCACCAATAGGAATCCTAA
GTCTCTATGGACCACCCGTCGTGGTGATCCTAAATGTATGTAGTCTTTGGTGTGTCTACACCAAGG