Description :
From Genome Similarity Track
Location :
Scaffold_53:36682- 37697
Sequence
1015 bases(100 bases per row)
AAGGTTGGAACACCTATCATCATGATTAGAAACCTGAATAGCGACGCAGGACTTTGCAATGGAACGCGGCTTCGGGTTGTGTCACTGCGCGAGAGAAGCA
TCGAGGCCAGCATTATGTCCGGGCCGTTCAAGGGTAAGAAGATGTTCATTCCTCGGATCGTCTTTTATAGTGAGGACGATGACAAGGAGTTCCCGTTCAA
ACTCAAGCGTAAGCAGTTCCCTGTGGTTCCAGCGTTTGCCATGACTATCAACAAGGCCCAAGGACAATCGATCCACCACGTGGGTATCTACTTGGAATTA
CCGGTCTTCGCACATGGCCAGCTGTATGTGGCTTTGTCGAGAGCTACTTCAAGGAAGGCGATCAAGATTGCTGTGGATCCAGAGACCATCGATAAGGACG
GGAACGTACACACCAACAATACTGTGTACAGAGAGATCTTTGGAACGCGGACTTGGTAGGTCACGTAATGCATATAATATATATAGCTTTGAGTTCGAAA
TGTTATTTAATCCACCGCAGCGCAGTGGAGGCGGACAGCCCACACTACACCAACCAACCATGCCCTAGCGTCCGCGGAGCGGGCGCCCAGACCGCTAGTC
TCCCCGCTTCTAACCTTGTAGCGTGTAGGTCTGTCTGTCCGTCTATCAATCCGTCCGTCGCACTCCCTGTCTTTCTGCTTTGACCTGCCTTTTCGCATGG
CTACACTCGGCCTTTCTAATATTGTTTCGTCCCATCTTATGGACGGCGCCTATCTTTCTGACTCGACCTAACTATGCCAAAATTACAATTATAGCAAAAA
CGCCACACAATTAACTCGCGCCCTGATTGGGCAATACCTTCCGACCTGCGACACTGACTGGATCTGTCGCACGATCAGACCGTCTCTCGCCCTCGCGATT
GGACGTAAGAAAAACATTTCTGCCGAGCACGAAACGCATCGATTGGTTGCAAATAGCCAGGCGAGCTGCGCAGATACTTGATTATTGACATTTAGCTACG
CAAAACCTGTCGTAT