Description :
From Genome Similarity Track
Location :
Scaffold_4:366776- 368188
Sequence
1412 bases(100 bases per row)
CCATTTTAGTTTTGTAATCATCATGCTCGCAAGCGATCCAGTGCGTGCCCGGGTTCAATAGAGCAAAAAGTGTAAGTACGGACGAGTATGCTCCCGACGT
CATTAATCAGTTATTGAACTTGTCGATGTGGATGCAGGGTGAAACCAACAAACGGGAGCTAAAAGAAGACGGCGCAGGGGTGTGATGTACACGTACTAGT
ATAGTAGTTAGTACTTCTTCGAAATGGAGGTAATCTTGATAAATATTGAGCCGATTCCGGTAGACACATTCCTCATCCAGTGGAATCACTCCCCTCGTTA
ACAGCTTCGGCATTAAAGTGTTACGGGTGTGAAACGCTCACTTGGATGCAATCTGCTCCAAGCGCTTGACTTTTCCATCTAGATACAGCAACATGTCGTC
TTTTGCGTCCAACGCGTCTTTCAGTTTCATCACGATTTTCCTGCAACATTTATCGTTAGTCAAGCTTAGGCTTTAAGACGGGGTAAGGTCAGCTCGTACC
TTAATTGCGCAACTTCGTTGAGTGAGCTCGCCTTTTGAGCCTTTTCCGGATGCACTTCGGGGTGCTGCTTCAAAATTGTAGTCTCGGCGTCCTTGTCGTT
GGAGCTTGGGCGTTCTGTCCATGGTTTAACTTGAGGCGAGGCCTCGCACACAACCAACAACTCGTTGGTTAGAGCACTCAGATCTGTCAGTGTCTTCAGC
AGCGAAGACCGTTCAGCGTAGTCTTCGTCTTGAGCTTTCTGGGGATCCTTAGGATGCATTCCTGTCGTCGTTTGGTTACTGGATACCATTTCGTCAAACC
ATGCATCAAGGCTGCTCAATTGCCCCTTCACGGTCTCAGGTGTTGCAGGGTGGTGTTGGTCATTCGTGAGCCGAGAAGACTCCCCATCAGCCTGCTGCAT
GTTGCACAGTTCCTGCGCCACAACAAGACCGTGCTTTAAATGTTCACTGGAGATTCGTAGCAGCACGCATTGCGTTTCGGCTCGTATCCACCGCTGACTG
CAAGCTTTGAGGTCGATTCGGCACTCTTGCAGTTGCTCCGCAAACTTGGATGCGAGTTGTTCAAGTGCTTTGTTCTGGCTCTGAGCTTCCCTGGTTCGAT
TAATTTCTTCTCTCAACTCGCTCGAAAGGGTCTCCATTTGTGCCTTGAGATCTTGGATTGTGCTGCAGTAGTTCATCTTGATCGAATGCTGCCGGTTCTG
TGACTTGTTGAAAGTGTATGCTTGACGTTGCAAAGTCTCATGTGTGGCCATGCATGCCAGGCGTTCGACTTCCAGTTGCCTCTCCAACCTTGCCAATTGT
TCAGCCAATATCTGGTGTGCAGTCTCTAGCTGTAACGCAGATTCTTCCATTGATCGGCATCGAAGCACTTCATCGTCGCGCTCAAGCTCCAACTGCTGGC
ATTTCCCCCAAA