Description :
From Genome Similarity Track
Location :
Scaffold_1:3667668- 3669608
Sequence
1940 bases(100 bases per row)
GCATCGCCCACGCCTTCAACAAGCTCAACGAAGCCACCATTACGGCGCAGACACCGGTTCCCCGGAAGGACATGGTGCTCGACACCATGTCAGGTAGCAC
TAAGTACAGAGCCATTGATTTAATAGATGGATCCTATCAGATCTTGATGTGTGAGGATGCCGTGCCACTAACCGCTGTCAGCACGCCCAGTGGCACGCTC
TGGGAATAGCTTGTCCTGCCACAGGGGCCGAAGAACGCCCCTGCCACCTTCGATCGCATGGTCTCGAACCTACTGCGGCCCTTCCGAGACTTCGTGTCCA
GTTACTTCGACGACATCTTCATTCACAGTCGTGTCGAGGACGGTACAACGGACGTGGAGGTCCACCTGCGGCGCCTCTGTCAGGTGTTTGAGGTGATGCG
AGACAACAAGCTGTACGCCAACTTGAAGAAGAGTATTTTCTGTGCTCCCGAGATCCCAGTGCTCGGGAGCTACGTCAGCAAGGATGGTGTCCGCTTGGAT
CCGAAGAAAGTCGAAGCCATCTGCGCTTGGCCGGCGCCGCAGGATCCGAAGCAACTTCGGTAGTGGTTGGGACTGGCGACGTATCTTGACCACTCCTCGG
AGAATTTTGAGGCAACCGTTCGCCCGCAGTCGCAGTTCCTCGAGGTTGACGCCACGTGACCGTGGCGTCCTGACCATCAACCGCGTTCGACGCTATGAAG
AAGAGCTTGTCCTCAGCACCCGTCCTTATATTGCCTGACCACCCGAAGCCCTTCCACATTGTCTGCGATGCGAGCGACTTCGCTATTGGCTGCGCCCTGA
TGCAGTTCGACGAGGATGAACGCGAACGCGTGGTGAGCTACCAGTCGCGTCAGTTGAAGCCGGCGGAACGCAACTATCCCGTCCAAAATAAGGAGCTGCT
GGTCATGCGCTACGCACTAATCAAGTTTCGTGTCTACCTTCTGGGGGAGCAAACCTTCGCCATCTACACGGACCACTCCTAGCTGCGGATAGCGACGAAG
AGCCCTCACCTTCCCAGCGCATGGCGCTCTGGCTCTCATTGTTCCCCGAGTTCAATTTCGTCGTTCACTAAACCCAACATCCTCGCCGACGCGCTGTCGC
GTCGACCAGACTATGTTCAGTCGTGTCGCCACGCGGGTGGCGACGAGGATGACAGCAACTGCGCAGTTTTCGTCGCAGAGGAGCTGGCCGCGGTCGCTGT
TACAGCAACCTGCCCGCTCCGTGACCTGGTAGCATCGGCGTGCGAGTCGGACCATGCGTGTGTAGAGATTATCAAGTACATGAAGGACCCGTCCGCCGCG
GCTCGGCGTCAATTATCTCCGCTTCACCGCTCCAGCGTCGACAGCTACACGCTGGATGGGAACCTTCTCACCTATTGCGTTGACTGTTTGGACCCTCCTC
GCGTCGTCGTCCCGCCGGACGACGGCCTCCGCGCTCGCCTGATTCACGAGTTTCATGATACTCCCAGTGGCGGCCACCTTGGTCACGAAAAGCCGTTCAC
GTCGCTGCCTTGCGACTACTACTGGCCACACATGTACATGTGGGTGCAAAAGTGGGTCCGCTCCTATGAGGCGTGTCAGCGCGTGAAGCCAAATTCGTCG
AAACATGCACCTCTCCGACCGCTGCCTGTCGCCTCGGAGCCTTGGTCATCTATCAGCATGGACTTCGTGTTTGGGCTACCCCAGGACGCCCAAGGCCGCT
CCGGCATTCTCGTCTTCGTTGATTGTTTTAGGAAGATGGTGCATCTCACTCCGGCTGCCGCCACGATCACCGCGCAGCAGCCCGCGGCGATTTTCGTCGA
CACCGTGTATCGCCACCACGGCCTGCCCACCTCGATCGTGTCCGATCGAAATCCCCGGTTCACTGCTTCTTTCTGGTCGGAGCTCCTTAAGCGCGTTGGG
ACGCGACTAAAGATGCTCACCGCGTCGCACCCGGAGACGG