Description :
From Genome Similarity Track
Location :
Scaffold_1:3667661- 3669606
Sequence
1945 bases(100 bases per row)
GGGTGAAGCATCGCCCACGCCTTCAACAAGCTCAACGAAGCCACCATTACGGCGCAGACACCGGTTCCCCGGAAGGACATGGTGCTCGACACCATGTCAG
GTAGCACTAAGTACAGAGCCATTGATTTAATAGATGGATCCTATCAGATCTTGATGTGTGAGGATGCCGTGCCACTAACCGCTGTCAGCACGCCCAGTGG
CACGCTCTGGGAATAGCTTGTCCTGCCACAGGGGCCGAAGAACGCCCCTGCCACCTTCGATCGCATGGTCTCGAACCTACTGCGGCCCTTCCGAGACTTC
GTGTCCAGTTACTTCGACGACATCTTCATTCACAGTCGTGTCGAGGACGGTACAACGGACGTGGAGGTCCACCTGCGGCGCCTCTGTCAGGTGTTTGAGG
TGATGCGAGACAACAAGCTGTACGCCAACTTGAAGAAGAGTATTTTCTGTGCTCCCGAGATCCCAGTGCTCGGGAGCTACGTCAGCAAGGATGGTGTCCG
CTTGGATCCGAAGAAAGTCGAAGCCATCTGCGCTTGGCCGGCGCCGCAGGATCCGAAGCAACTTCGGTAGTGGTTGGGACTGGCGACGTATCTTGACCAC
TCCTCGGAGAATTTTGAGGCAACCGTTCGCCCGCAGTCGCAGTTCCTCGAGGTTGACGCCACGTGACCGTGGCGTCCTGACCATCAACCGCGTTCGACGC
TATGAAGAAGAGCTTGTCCTCAGCACCCGTCCTTATATTGCCTGACCACCCGAAGCCCTTCCACATTGTCTGCGATGCGAGCGACTTCGCTATTGGCTGC
GCCCTGATGCAGTTCGACGAGGATGAACGCGAACGCGTGGTGAGCTACCAGTCGCGTCAGTTGAAGCCGGCGGAACGCAACTATCCCGTCCAAAATAAGG
AGCTGCTGGTCATGCGCTACGCACTAATCAAGTTTCGTGTCTACCTTCTGGGGGAGCAAACCTTCGCCATCTACACGGACCACTCCTAGCTGCGGATAGC
GACGAAGAGCCCTCACCTTCCCAGCGCATGGCGCTCTGGCTCTCATTGTTCCCCGAGTTCAATTTCGTCGTTCACTAAACCCAACATCCTCGCCGACGCG
CTGTCGCGTCGACCAGACTATGTTCAGTCGTGTCGCCACGCGGGTGGCGACGAGGATGACAGCAACTGCGCAGTTTTCGTCGCAGAGGAGCTGGCCGCGG
TCGCTGTTACAGCAACCTGCCCGCTCCGTGACCTGGTAGCATCGGCGTGCGAGTCGGACCATGCGTGTGTAGAGATTATCAAGTACATGAAGGACCCGTC
CGCCGCGGCTCGGCGTCAATTATCTCCGCTTCACCGCTCCAGCGTCGACAGCTACACGCTGGATGGGAACCTTCTCACCTATTGCGTTGACTGTTTGGAC
CCTCCTCGCGTCGTCGTCCCGCCGGACGACGGCCTCCGCGCTCGCCTGATTCACGAGTTTCATGATACTCCCAGTGGCGGCCACCTTGGTCACGAAAAGC
CGTTCACGTCGCTGCCTTGCGACTACTACTGGCCACACATGTACATGTGGGTGCAAAAGTGGGTCCGCTCCTATGAGGCGTGTCAGCGCGTGAAGCCAAA
TTCGTCGAAACATGCACCTCTCCGACCGCTGCCTGTCGCCTCGGAGCCTTGGTCATCTATCAGCATGGACTTCGTGTTTGGGCTACCCCAGGACGCCCAA
GGCCGCTCCGGCATTCTCGTCTTCGTTGATTGTTTTAGGAAGATGGTGCATCTCACTCCGGCTGCCGCCACGATCACCGCGCAGCAGCCCGCGGCGATTT
TCGTCGACACCGTGTATCGCCACCACGGCCTGCCCACCTCGATCGTGTCCGATCGAAATCCCCGGTTCACTGCTTCTTTCTGGTCGGAGCTCCTTAAGCG
CGTTGGGACGCGACTAAAGATGCTCACCGCGTCGCACCCGGAGAC