Description :
From Genome Similarity Track
Location :
Scaffold_1:3667659- 3669608
Sequence
1949 bases(100 bases per row)
GAGGGTGAAGCATCGCCCACGCCTTCAACAAGCTCAACGAAGCCACCATTACGGCGCAGACACCGGTTCCCCGGAAGGACATGGTGCTCGACACCATGTC
AGGTAGCACTAAGTACAGAGCCATTGATTTAATAGATGGATCCTATCAGATCTTGATGTGTGAGGATGCCGTGCCACTAACCGCTGTCAGCACGCCCAGT
GGCACGCTCTGGGAATAGCTTGTCCTGCCACAGGGGCCGAAGAACGCCCCTGCCACCTTCGATCGCATGGTCTCGAACCTACTGCGGCCCTTCCGAGACT
TCGTGTCCAGTTACTTCGACGACATCTTCATTCACAGTCGTGTCGAGGACGGTACAACGGACGTGGAGGTCCACCTGCGGCGCCTCTGTCAGGTGTTTGA
GGTGATGCGAGACAACAAGCTGTACGCCAACTTGAAGAAGAGTATTTTCTGTGCTCCCGAGATCCCAGTGCTCGGGAGCTACGTCAGCAAGGATGGTGTC
CGCTTGGATCCGAAGAAAGTCGAAGCCATCTGCGCTTGGCCGGCGCCGCAGGATCCGAAGCAACTTCGGTAGTGGTTGGGACTGGCGACGTATCTTGACC
ACTCCTCGGAGAATTTTGAGGCAACCGTTCGCCCGCAGTCGCAGTTCCTCGAGGTTGACGCCACGTGACCGTGGCGTCCTGACCATCAACCGCGTTCGAC
GCTATGAAGAAGAGCTTGTCCTCAGCACCCGTCCTTATATTGCCTGACCACCCGAAGCCCTTCCACATTGTCTGCGATGCGAGCGACTTCGCTATTGGCT
GCGCCCTGATGCAGTTCGACGAGGATGAACGCGAACGCGTGGTGAGCTACCAGTCGCGTCAGTTGAAGCCGGCGGAACGCAACTATCCCGTCCAAAATAA
GGAGCTGCTGGTCATGCGCTACGCACTAATCAAGTTTCGTGTCTACCTTCTGGGGGAGCAAACCTTCGCCATCTACACGGACCACTCCTAGCTGCGGATA
GCGACGAAGAGCCCTCACCTTCCCAGCGCATGGCGCTCTGGCTCTCATTGTTCCCCGAGTTCAATTTCGTCGTTCACTAAACCCAACATCCTCGCCGACG
CGCTGTCGCGTCGACCAGACTATGTTCAGTCGTGTCGCCACGCGGGTGGCGACGAGGATGACAGCAACTGCGCAGTTTTCGTCGCAGAGGAGCTGGCCGC
GGTCGCTGTTACAGCAACCTGCCCGCTCCGTGACCTGGTAGCATCGGCGTGCGAGTCGGACCATGCGTGTGTAGAGATTATCAAGTACATGAAGGACCCG
TCCGCCGCGGCTCGGCGTCAATTATCTCCGCTTCACCGCTCCAGCGTCGACAGCTACACGCTGGATGGGAACCTTCTCACCTATTGCGTTGACTGTTTGG
ACCCTCCTCGCGTCGTCGTCCCGCCGGACGACGGCCTCCGCGCTCGCCTGATTCACGAGTTTCATGATACTCCCAGTGGCGGCCACCTTGGTCACGAAAA
GCCGTTCACGTCGCTGCCTTGCGACTACTACTGGCCACACATGTACATGTGGGTGCAAAAGTGGGTCCGCTCCTATGAGGCGTGTCAGCGCGTGAAGCCA
AATTCGTCGAAACATGCACCTCTCCGACCGCTGCCTGTCGCCTCGGAGCCTTGGTCATCTATCAGCATGGACTTCGTGTTTGGGCTACCCCAGGACGCCC
AAGGCCGCTCCGGCATTCTCGTCTTCGTTGATTGTTTTAGGAAGATGGTGCATCTCACTCCGGCTGCCGCCACGATCACCGCGCAGCAGCCCGCGGCGAT
TTTCGTCGACACCGTGTATCGCCACCACGGCCTGCCCACCTCGATCGTGTCCGATCGAAATCCCCGGTTCACTGCTTCTTTCTGGTCGGAGCTCCTTAAG
CGCGTTGGGACGCGACTAAAGATGCTCACCGCGTCGCACCCGGAGACGG