Description :
From Genome Similarity Track
Location :
Scaffold_2:36670- 38203
Transcript NameFunction/comments
Physo_312197Hypothetical protein

Sequence
1533 bases(100 bases per row)
CCGGACTCTCCCTCTCAACGCGTTCAATGTCTTTTGGTGGACCAGTCGATCATTCAGCAAACGGACACTAGCGTCGGGAGCTCTCTCGACGCTAGCCAAG
TCCCAGGGCCAATGATTCAGCTGTTTAACCCTTTGGCTGCGCTGTTCTTCATTCCGTTCCTCGAGAAGGTGGTCTACCCGCTCTACGCGAAATACTCTGG
GAAGCCTCCAAGTCCGTATGGGAAAATCCTCACCGGCTACTGTGTCGCTGTGGTGGCGATGTTTTGGACTGGCGCCAACGAAGTCATCCGACGCAGCGCT
GGCCCACTTTCGTACACGGACGCGGATGGTGTTGAACAATTTCTGCTTGATGACGACGGAGGCCAAGTGATGAACGACATTCCTTGGTGGACCACGATCC
CGCACTACCTGCTGGTATCGCTACCCGGTGTGCTGATCTGCATTCCGAGCTACGACCTGAACTATTCGGAGGTCCCGCAGAGCATGCGCAGCACTTCGAT
CGCACTCGCGTTCTTCGTCAACTCAATGGGCAGCTCCTTGTTATCTATCATTGTGTGCTCTTTGGCAAGTACATCCCGGCCAATCTCAACAATGCACATC
TGGAGTATCTGTTCTTCACTCTCGGCGCGCTTATGATCGTTAATATCTTCTTTTATGTAGTCGTCATGAACCGGATGAAGTTTGGGACGAATAGCAGGTG
CAGGAGTCCAGCACTGCTTAAAGAATACACTCTTTCTGTTTTTCTCACTCAACATTTCCCAGCATTATGCTGCATTTCTTGGTTTACTAGCTAAGCACTT
AATCATGTTTTCGATTTCTCGCAGGACGTAGAGTCTTCTGATTTGGTTCAGTAGACTCTACCAGAGGCGGCAAGACCTACAGTAGAGTCTACTAACTGCC
CAGTGAAAATTAACTAGTATCCATTACTGTACAGACAACGACGATGAAATACGTCACCATTGGTCTAACCTGCACATTTGCACATTTGATGGCGCCTTTT
GTAATGGTTGTTGTCTGACTGTACTGTAGATAGATTCGAATACAATAATCCAATAATTTACTGTAGACACAACCCATACCATCCGAACTACATGTAGATC
ACTTTGACCGTCAAAACACCTGAACGTAAATCGAACGGGACACTGAACTAGCACGATATTTCGAGGTGAGTTAGCGAACTATGTTGAACATGTAGTCGCC
ACAGGGTCGGCCTGGTCGACTCGACTAGACCACAATAGATCATCCTAAAGACACGCTTACAACACGCAGCAGCAGCAGGAAAAAATCAGTCAATCGAGAC
GAATGCCCGTGCCCGGCTCACCGATAGGCGTCGACGAAAGAACCAGGTCGCAATGCATTGGTGTGTCGATCTAGCGGCCCGCCCAGTGCATCGCGCGTAG
TGGATCACGCAGGACTGCTTGGAGGTCCATTCTTCCCGTTGAAATGCTTTCTGCATAGCCGGGCTTTGTGTGTGGTTGAGAACCGCCCGCACGATTTGCA
CAAGTTGAAGCGATTGATTGTGCCTACTCATCC