Description :
From Genome Similarity Track
Location :
Scaffold_246:3667- 5235
Transcript NameFunction/comments
Hyaar_Emoy2813146PREDICTED: dnaJ homolog subfamily C member 7 isoform 1
Hyaar_Emoy2813147predicted protein

Sequence
1568 bases(100 bases per row)
TGCAGAACGGCAGCAGCGCCAAACTTGCTGGGAAGACGCGGCGCGGAGTAAAAGCCGACCTTACGACCGGTACAGGCGGGGCGGACGTAGCAATTGTGGG
AGCAGTAAATCCCAGTCGTCAGGTGCCAGTAGTCGAGCTTCATTTATGGCGACGAAGACCGAGTGCCGTACGCACTACGAAGTGCTTGGTATCGATAAGA
CAGCGACGAGCGACCAAGTCAAGAGGTCGTACCGCAAATTGGCGCTCGTGTATCATCCAGGTAAGCTGGTCAATTGGCAAGAACCGTGCTGTCTTCGATT
GCTAATGATGCTCCTTGCTAATGCGTTTGCACTTGCAGATAAATCAAAGGTGTTGTCGCATGCTGATTTGTTCAAGGAGATGACAGCCGCCTATAACGTG
CTCTCCGACAAAAGTGCCCGGGATAAGTATGATCGCGAGTTGATGTATAACAAATTTGGCAATTTCTACGAGAACTAGCGAGAGCGGGGAACGAAAGCAT
GAGTGTTGAGTCCTGTGGTCGGTCAGTAACAACATTGAAGTAATCTGACTCGTGTGACTATTAGTTTGGATGTCTTTAGGCGAGGTCATAAGAAGTCCTC
ATATGTCACCGACCTCCGACGCAATGGGTGCCATGCAGCGCTTGGTCATGTTGCTAGGCATCAAAGACAAGCGATTGGGCAGATCGCGCGACTTTGACAT
GCTAATGACGAAGCTGCGACGGATGTCTCACCTCTGAACGAGAGCGAAAGAGCATCTCCCAACCCGTGTAAATGTCCCTGATTGCACGCCACAAACAACC
CAAGTACCAGCACTTGCCACGACACAAGTCCAAGGAAAAAAAACAGACCTTGGTTCATCTCGGCTCGTTCATTGTTGTTACCCCTTCTCCATCCAACGTC
TTGAGTCACTCTTCCTGCTTGTCCCCTTCATTCAACGACTGAACCTGGTGGCAGAACGCACGGACATTTGGCTGCAAGTAAAGCGACTTGCGCACGTGGC
GTTTCGCATTCAGATACTCCTGTGCCTCTTGAGGGTCCATTTTACGAGCAGCTACGAGCCAACACAAGGCCACCGCCGCACTTCGTCCCGTGCCTCCTTT
GCAGTGAACGTACGTCCTGACTCCCCGTTGTTTCTGCATCTGGATGAATGCAACAGCCGCTGTTAATGCCTCAAGTGACGGCTCAAAGTGGTCAATTGTC
GGCAGTCGAAGCTGCTGGATGTGGTGCCTCTTGTACTGGTTCGTAGGGCCTGCGTACTCATCACATAGATTGACAACTGCACCAACCCCACGAGCAACTA
GAGCGTCGACATGAGGCAGAAAAGTCATAGGCGCTGCTCCCAGCAGGACATGCGAGTCCACCAGCGTCCAGTAGTTCCGACGTCGCGACAAGTACGTGAG
TGGCCACGTCGGGTAAAAGAACACTCGGGCTGTGACTTGAGCTGCTGGCTTGGGCAACAGATGCAGTTGGAACGCAGCATAGAGCACGAGGGGTGCGAGT
GTCCAGATCTGCCAGCTAGTGATGGTTTTCCAAATCAAGTCATCCATTGCCAGCCAACAACGACGACG