Description :
From Genome Similarity Track
Location :
Scaffold_2:36669- 38135
Transcript NameFunction/comments
Physo_312197Hypothetical protein

Sequence
1466 bases(100 bases per row)
TCCGGACTCTCCCTCTCAACGCGTTCAATGTCTTTTGGTGGACCAGTCGATCATTCAGCAAACGGACACTAGCGTCGGGAGCTCTCTCGACGCTAGCCAA
GTCCCAGGGCCAATGATTCAGCTGTTTAACCCTTTGGCTGCGCTGTTCTTCATTCCGTTCCTCGAGAAGGTGGTCTACCCGCTCTACGCGAAATACTCTG
GGAAGCCTCCAAGTCCGTATGGGAAAATCCTCACCGGCTACTGTGTCGCTGTGGTGGCGATGTTTTGGACTGGCGCCAACGAAGTCATCCGACGCAGCGC
TGGCCCACTTTCGTACACGGACGCGGATGGTGTTGAACAATTTCTGCTTGATGACGACGGAGGCCAAGTGATGAACGACATTCCTTGGTGGACCACGATC
CCGCACTACCTGCTGGTATCGCTACCCGGTGTGCTGATCTGCATTCCGAGCTACGACCTGAACTATTCGGAGGTCCCGCAGAGCATGCGCAGCACTTCGA
TCGCACTCGCGTTCTTCGTCAACTCAATGGGCAGCTCCTTGTTATCTATCATTGTGTGCTCTTTGGCAAGTACATCCCGGCCAATCTCAACAATGCACAT
CTGGAGTATCTGTTCTTCACTCTCGGCGCGCTTATGATCGTTAATATCTTCTTTTATGTAGTCGTCATGAACCGGATGAAGTTTGGGACGAATAGCAGGT
GCAGGAGTCCAGCACTGCTTAAAGAATACACTCTTTCTGTTTTTCTCACTCAACATTTCCCAGCATTATGCTGCATTTCTTGGTTTACTAGCTAAGCACT
TAATCATGTTTTCGATTTCTCGCAGGACGTAGAGTCTTCTGATTTGGTTCAGTAGACTCTACCAGAGGCGGCAAGACCTACAGTAGAGTCTACTAACTGC
CCAGTGAAAATTAACTAGTATCCATTACTGTACAGACAACGACGATGAAATACGTCACCATTGGTCTAACCTGCACATTTGCACATTTGATGGCGCCTTT
TGTAATGGTTGTTGTCTGACTGTACTGTAGATAGATTCGAATACAATAATCCAATAATTTACTGTAGACACAACCCATACCATCCGAACTACATGTAGAT
CACTTTGACCGTCAAAACACCTGAACGTAAATCGAACGGGACACTGAACTAGCACGATATTTCGAGGTGAGTTAGCGAACTATGTTGAACATGTAGTCGC
CACAGGGTCGGCCTGGTCGACTCGACTAGACCACAATAGATCATCCTAAAGACACGCTTACAACACGCAGCAGCAGCAGGAAAAAATCAGTCAATCGAGA
CGAATGCCCGTGCCCGGCTCACCGATAGGCGTCGACGAAAGAACCAGGTCGCAATGCATTGGTGTGTCGATCTAGCGGCCCGCCCAGTGCATCGCGCGTA
GTGGATCACGCAGGACTGCTTGGAGGTCCATTCTTCCCGTTGAAATGCTTTCTGCATAGCCGGGCT