Description :
From Genome Similarity Track
Location :
Scaffold_53:36661- 37674
Sequence
1013 bases(100 bases per row)
CCTCCGCACAGGATTGTTCTGAAGGTTGGAACACCTATCATCATGATTAGAAACCTGAATAGCGACGCAGGACTTTGCAATGGAACGCGGCTTCGGGTTG
TGTCACTGCGCGAGAGAAGCATCGAGGCCAGCATTATGTCCGGGCCGTTCAAGGGTAAGAAGATGTTCATTCCTCGGATCGTCTTTTATAGTGAGGACGA
TGACAAGGAGTTCCCGTTCAAACTCAAGCGTAAGCAGTTCCCTGTGGTTCCAGCGTTTGCCATGACTATCAACAAGGCCCAAGGACAATCGATCCACCAC
GTGGGTATCTACTTGGAATTACCGGTCTTCGCACATGGCCAGCTGTATGTGGCTTTGTCGAGAGCTACTTCAAGGAAGGCGATCAAGATTGCTGTGGATC
CAGAGACCATCGATAAGGACGGGAACGTACACACCAACAATACTGTGTACAGAGAGATCTTTGGAACGCGGACTTGGTAGGTCACGTAATGCATATAATA
TATATAGCTTTGAGTTCGAAATGTTATTTAATCCACCGCAGCGCAGTGGAGGCGGACAGCCCACACTACACCAACCAACCATGCCCTAGCGTCCGCGGAG
CGGGCGCCCAGACCGCTAGTCTCCCCGCTTCTAACCTTGTAGCGTGTAGGTCTGTCTGTCCGTCTATCAATCCGTCCGTCGCACTCCCTGTCTTTCTGCT
TTGACCTGCCTTTTCGCATGGCTACACTCGGCCTTTCTAATATTGTTTCGTCCCATCTTATGGACGGCGCCTATCTTTCTGACTCGACCTAACTATGCCA
AAATTACAATTATAGCAAAAACGCCACACAATTAACTCGCGCCCTGATTGGGCAATACCTTCCGACCTGCGACACTGACTGGATCTGTCGCACGATCAGA
CCGTCTCTCGCCCTCGCGATTGGACGTAAGAAAAACATTTCTGCCGAGCACGAAACGCATCGATTGGTTGCAAATAGCCAGGCGAGCTGCGCAGATACTT
GATTATTGACATT