Description :
From Genome Similarity Track
Location :
Scaffold_29:366458- 370932
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G010118Similar to mnmE: tRNA modification GTPase mnmE (Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966))
Pytul_DAOMBR144PYU1_G010117Similar to YMR317W: Uncharacterized protein YMR317W (Saccharomyces cerevisiae)

Sequence
4474 bases(100 bases per row)
TCGCTATACTTCCCTGCTATTATACTAGTGTGTTCGTATCCGCATACCGGCATGTGGCTCAGTGCCTCCATGACGCCTGACACCACGGCGATGCTTCCGT
GCACATGCAGCTCGACCACATCTTCACCCGTGAAGCTATAGTGTACAACAAGACCTTGATCACCATGTACAGCGCTATCACATGCCTAATAACAAAACGC
ATATTCATAGAGAGAGAAAGCAGCGCACCTTCGTGGTTGAGGAAAGCGGATCGCGATGGCGTCGTCCAAATGCTCCTTGGAGACAGGATGATAGAGCTTC
CGGAACGCCGCCCTGTCGATGGCCACAGCGTGTCAATAGAGAGACAGAGTGAGAAAGAGAGAGACACACACAATGATAAATGAATGAATGCCGTACATTC
GCGCTTCTGGGAGCGTCTCGGTCTTGCTCAGTTGCCGCAGACACTGCTCGGCGCTCTCCCCGGAGATGCGGATGACGGCGACGCCCGCCTTGCCCTCAGC
CGACGACAACGCATAGATCGTGTCGCTCTCCGCTGCTGTGCCCAGCGCTCTCGCTGCTGCGTATCGGGGTACAGCAGTAGCGGACGCGCGGCGCGAACGA
AGCGCACGAACGCGGCGAAGCAGCATGTTATGTCCGTCTTGTGGTTGACAACAAAATACTGCCGTTGGTATCAGACTGTTTGGTATCAGACTGTTTGGTA
TCAGACTGTTTGGTATCAGACTGTTTGGTATCAGGCTGACTCAGATGTCGGTATCAGACTGAGCAGGACGAAGGTGTCAGACTCAGGATGTTGCAGTTGG
CGCTGAGCTGCTCGAAATGATTGAGGATGATCAAGGTTCATTCTTGAGCCCTGGAGGATGGAACACATATTTTTTGTAGAGTATGTACTACTCATTGGTA
TTTATGCAATGCGTTTTTTTTCACTGCATACAAATTCCAAATTAAACTATTGTCATACCAGCTCCTGGCCAAAATTACCCCTTTAAAGTGAATATTTGTT
AAATTATAACGGATTGAGAGGGATTTCATCCATACAAACGCTTGATTGTGTCATCAAATTGAAGGCATTTTTTCGAGTAATTGCAAGATGTTGATGAAAA
GGGTGGTTGCGACTTTGAGTTTTCTGACGACAGCGCATTTTATCATTAGTTTTGTATGCCGTCCATTTGGCATTTATCCCAGTACACACCATCTCGAGCC
GTGATGATGGTGCAGCAACCGTAGCTCATTGCGGCTTTCTCTCTCTCTCTCTCGTTATAACAAGACAAGACGCGGATAATGGCGAAGGCGGTTGTGTCCC
CGACGCAATTCCTGCAGCCGCGGTGGCTGCTTGTTGGCGCGCTCATCGCGCTGCTCTCGTACGCGACGCCCGATGCTGTCGACATGCTCCAGAGTGGCGT
GGCGCCGCCTGCGTCCGCGCTCAAGCCGTACCCGGACCTGCGCAGCTTCCGATCGCGCTAGTACGCTGCATATCACTATGCGATTTTGTAAGGCGCTTGC
GCATACTTATTAACTCGTATGTGTGTGTATATGTGTATGCCGTTGTAGCCAAGCGGACCATCAGGATGAGATGTCGGTGACGCTGCATGTCGTTGGCACG
TCGTTTGTGGTGCTGTTCCTACTCATGCACCCAAAGCTCATCGGAAGCGGTGTCTTGGCGCGTATGTACCCTAGTCGTTAGTCTACCTTTGCGCATTGCT
TCCTTCGTACTAACACGTCCATTAATGTCGCCAGTCAAGTGCGGCCAGGTCGCGTTCGCGCTCTTCCGCCACCACGACAGCGGACTCGTGGAAGCGCTGG
TCATGCTCGCGGTGTTTTTACTCACGACGCGGTTCCTGGGCGGCTCCATGTCGTCGGCAATGCTCGTGACGTTCGTCGGGTACTTTTTCGCGTGGACGGG
CCATTTCTTCTACGAGGGCAACCGCCCCGCGACGTTCATCTACCCGACGCACTCGCTCATCTGCGACTTCATCATGTGGGCCGAGATCGTCACTGGAGCC
TCCATCGCGCTCTAGTGGTGGTCGTGTCATTACGTAAGTCATTGTGTACATGTGCACCAGGTTCATGCATCTACTCGTTTGATTCTAAATGTTTTGCGCG
TATAGTTTGCTTTTACTTGCACGGGCAGCAATGCTTGTGAGAGTGGGGTATTATTCTATGGTTTGATGCTGTTCAAATTGTTTTCTTTGCATGGGATAAA
TTGGGTTTAGATTGGCAAGCTGACGCCGTCAAAGTACTCGAGCATGTCGTCAATGTCGGTCATCGTCTCAAAGTTTGCAACGTTGTCAGGGCTACGACTG
CCGGAGGAGGTTTCCACCGTCGACTTCTCGTCACTTGGAGCTTGTGTCGCGATGAATCCCTCCGTCATAGCTGCTGCACTTTGCGCCTCAGTATCATTCG
TCATTGCGGACGCATCCTGTTGCACGGATTGCCATGTCGCTGCTTGCTGTGAGATCGCATCACCTGCAGCAACTGAGGCCATGCCCGCGCCTTCGCAACT
TGGTGAGGTTACATGGCACAACGACGCTCTTCTCGCGCTCGATGAAGGAGGACTCATGGCTGGTGGGATACTCGCGTTGAAATCGGCGTCAGTCGGGGAC
ATCAGCTCCATCGGCATCGGATAATTCCCCCATGCTGGTGCTGCAATGTCAATTGTGAGATCCGCGGGTCGACTACATGACTCTTGCTGCCGTATCCTGG
ACGATACTGGCGACTCTGGTGGTTCTAGCGTGTGGTCTTCTTCTGGCACCGCATCCAATATTTTGGTATTGATGCCCAACTTCTTGGTTCGCTTCTGGCT
GGTGCGGCCTCGAGTCGTCGCTGGGGTGAGCGATCGTGTGCCATTCGAATCCGTTGTTCTTGTTGAATTGGCAGCGCTGGACGCGTTCTTCTTCTCCATG
AGCAGCTCTATTTTGCGCTGCCGCAATAATTCGGTGGTCTGGATGAACGACTTGTGTGCGATGAGCTCGTGCTCTCGGTATCGATCGCTGCGTCGGCTGC
CGATATTCGCGCCCTGGCTCGCGCTGCGCTGTCGCACGTGCCCAGCCTCGAGCTGCAGCCGCTTCTGCTCTTCTTGCCACCGCATGTGGCGACTGCTCTC
CGTGGGTCCGTAGTATTTACTGCGCTGCATCAACTTGGCGGTTTCCCGGTCTTTGTATTTCGCCAGCGACTTCATCTTGTCGTGTCCGGCACCGCGGATT
TCAAAGAGTGCTTTCGAGATCGGGCGAAGCTTCACGTCCTGATCGGGCGACGATGGATGATCTTCCGTTGGATCATACAGCCACACGCTCGCGTGAATGC
ACGGCTTGTGCTTTGGCGAGAGGTGTGCCCTCGGAGTTCGAGTCGGGATGCTGCAGCTTCGGATTCGCGGCCGCGGCAATGGCGGAGGCTGAGTAAAGTC
GCGTACTGTCGCAGGTACCGGGGGCTTGTCGCCGTCGCTGTTGCCGATGCGCGTCCATTTTGTCAGCAGACGCTGGACCTCGCTGACTCCTTCGAACGGT
GGCTGAATGGTGCTCACCTCGACGTACTCGTTGAACTCCATCGATTCGGTATCAAAGAACACCTCGCGCTCGCTCAGTCGATCAAGCTTCGTGCCCACGA
GCACAACGCGCGTGCCTTCGTCGTCCGTCGCCAAGTACGACCACTGCAACACCACACAGAGCGCGCGTGTTAGCGTGAAGAAGCGCCACACAAGCAGATA
TAGATAAAGCAGATAGATACCTGCGCGACGGCGGCCGCAAACGAGTCTCTGCGCGTGAGATCAAACACGACGACGATGCAGACCAATGGTCCACAGCTGG
TGCTCCGAAAGGTCCCGAGTTGCTGCCTTTCTCGGAAGATCTGGAACGTGTCTCGACGTGGCGCCGGCAGCGCATTGTCGTCCTCGAACGGACCGCCGCC
TACCCGCAGCGCGTGCACGAGCGCCCGCTTGCCCACAGCGTCCTCGCCCACGACCGCGACCCACGGTGCTTGCTCCATTTTGCTGCGCTTTTTGGATAGT
GGCGAGTGCGTGTGTGTGCGTTAAAAATATCTGCAGTGTCAAAGTGTAGGTTTGTGACGAGGTGGGTATACTGAAACCAAGTAACTGGCGGTGTACGGTA
CAAAAACACACAAAAGCCAGCCGAAGTGGCTTGTTTCTGGCCAAACTGACTGACAAAAAAATTGTAAGCAGTGGAAGCTGACCTGACCTGACCCTGACTG
GCTGCATCTAATCGTAAAAGACGGTGCCTAGGTTCAACTACCTTTTTCAACTAATATATAGATGCATACTAATCATCCATTTTCTTATCCATTATATATT
TCTCCTGTTTTGCTACCTGTCTAATCTATATTTTCGTAAAAATGGAAAATCTCTATTGGAAAGGAATTGGGATCTGGGTCTGCAATTCAGTTCTCCTCAA
CCAGGGAGCGCGAAATGCAGCAGCAAAACTCAAAGCGTTGCTGACGCAATAGCTGGCTGTTTTTAAACAGAAAA