Description :
From Genome Similarity Track
Location :
scaffold_10:366374- 367992
Sequence
1618 bases(100 bases per row)
TTAGCCTACCCACATAAAATGTAGGATGTAGGCACATGCATGTAGGATGTTTAACGTATACGCATCACCATTACATTTCATCACCttgaacggtccaata
aatctTGGTAAATGCTTCTTGCTTCCAAAGTTGGACACTGCATGTTTAGGCATATTTGTCGTGCTAAGTAGTACGAGAACTTTGAACTTACATACCttcc
tcttcctcttccCCCTTCCACTCTTACctgcttgttctttttgcagatccTGAGCTTTCGCAATTGCGTCTCGAACAAATCGAACAACGGCTTGTCTCTT
CGCAATATGGTCATTGACGTTCTGTTTCTCACGACTTGTCATGCTGAGTCAAAATTCGTTTTTATCTTTGTGACAACGTTTAGGTCTAACTTCCCCCCAC
TTAGGGTAGAGACCTCGACCATTATGGAAGCAGGTACTCTAGGATGAATACCATGGCTCACATAAAATGGTGAACGACCTGTTGAGACTTGCGTGGAGTT
GTTCAACGCAAATTCTGCAAAAGGGAGATATTCACTTCGCTCTTTGAACGACGTTACGTAACTACGCAGTACGTCCTCCAGGACTCGATTCACACGCTCT
ATTTGACTGTCCATTCAGGGtgtgccgctgttgacatggacaATTTGGTGCCCAATAGTCCAAAAAGTGCACGCCGAAATTTTGACGTAAAGGGGGTGTC
ACGGTCAGACACGATCTCAACAGAAAGGCCAAGCAGACGGAAACCAACGTGTTCAGAGTTCTTAATTGTCTCTTTGGCAGAGATCTTGCATGAAACAGGC
GCAGGGGGCCAGAGAGAACCCGATGGTGTCACACTATGGCAAATCTCACAAGTCCTCCATACTCGCGCACCCATTTATACATGTGTGACCAATAGTAATC
CCAAAAAAGACTGATACACGTTTTTTCACGTCCAAGATGGCCAATCAAAGGGCTGTCATGGTACTCATATAGGAGACGAAGAGGCAAACCTTCGTCATTT
GGAGCAACAACTCTTGCATATCCCCGTGTTCATCCGCATAACACAACGTCGTGTACCCCAAAACGGTGAACACGCGATCTTGTGTGAGATGGAAgacctt
gcagtgctttgtcgaATGTTTTTTGAGATACCCCCAAATAgtcctgacatgtctcatcagACTTGTACCCATCGGCAATTTCTTCGTGCACTGTAGTCGT
AACTTGTACTCTGATCGTCTGAACATCttcgcattgtcgacatgactaGTGCATGTTTTCGCTTCTGGACTTTGGATCATAGCTCGGACGTCTTGGCAAC
GCATCGGCTGAGATGGTCGTCTTGCCTGGCTTGTAGTGCTcaacaaagttgtactcCGCAAAGCAGGAAAACCATCGAGCCATTCTTTGCGAGTCTCCAC
TGCCGTACGCAGTGAGGcgtgatctgtatagatcacaaacgctCCTCTCCAAGCAAGTATACATGGAACATAACCAAAGCATACTTCGTTGCtagaagct
ctttgtcatgaactggatagTTCCGCGGACCGGAAGTGTCGCGACTGATACGGAACAACTCGCTCTCGACTCATCATCAtgttgcatcaacgcacAACTG
ATGGCATAATCACTTGCA