Description :
From Genome Similarity Track
Location :
Scaffold_1:366355- 374702
Transcript NameFunction/comments
g120.t1RAW37424.1 Chromodomain-helicase-DNA-binding protein 9 [Phytophthora cactorum

Sequence
8347 bases(100 bases per row)
GGTAGCAAAGACGCACAACTTCATGCAGCTTCTGGATGGCTAATACTATATGCAGATAGAAACGAAGATGAGTAGGTTTCGGGTGCAGAAGCTGCGACTC
GCGATAACTCCATCAAGCCACAGAATACTACCGGTAGGATTCTTGATCATCGCCCAAGTGCGCTGGACGAGCAGATTGTGTAGGAACGGCTGGACAAGGT
TGTAGCTATGCTCATGATCGCACAACGATTCTCACGATTCGCCGGCAAATGAATGATGAGGACACGTTGTTAGCCATTTTGGGATCTACGGGACGCTGGT
GGAGACTTGGAGAAGCATTACTTGCTTTGCGCTTTTGTCTTCATCACAAAAGCATTTTATTCACGACATCGCGGCAGAATCAAGACATCTAAAGCGTTGA
GCATTGCAGTTACTGGAGCAGGGGGAACTACATAATATGTAGTCGTATTTATATTATAAATGAAGGCAAGTGTGGCGCGATCATATCGTGATCGTACTGC
ATTCATCCAAGCGAAAACAAACGCACGTCAACACGTGCGACTAGCAACACGCGCTGGTACAATACGTATTGAATACTTCAAAGTATTACGATGCAGGTCA
TCGCATCTTTGACTCGTTGTGTGATCTCCACTGCATTCCTACCCTGGCGAATTACGTGTAGGCGCTCCAAATCTTATCCATACCTAATGACAGCAAAGCT
GACGATACATATATGCATACACCTTGCTGCACGTCCAGCAAGTCAAGGTGATGCAGCAAGTGGAGCCATTTTCAACGCGGCACTTCGTACTTAGGCGGGA
CCAATTCATGAATTGCAGCATACAAACTTCGAGTGCCATTCCTGCGACTGCCATTTATTGGTTTGACTGCGCGCAGTCAAAGCGAGCGAGAAGAGCGTGG
GCGCCAGGCGGAATCGACGGCCGCGTGAGCCTCAGACAAGCGACTGGAGCGCCGACTGGTCGTGTACACGTCGCTCCCCATGGACAGCGGCATCTCCGAG
GCCGGTACGTTCCAAGAGAAGTGACAGAGGTCGCCCTTCGTACACTTGATTTGGCTTGTTCTTCAAGCGACGAAGTGGATAAAATTACTCTAACGGCGGC
TTGATTGGTTGCTTTGTGTTGACAGTCTTGGCGCCGGCAAACATCCAGCAGGAAACCCTCGCAGCTTCGCTGGCCCGAGTCGCAGCTACGGAGCAGATCC
TGGTTGATGAGCCTGAAGCGAGCCCTGTACGCTCTGCTACTGATGAGACAAATGATCAGGTAGCGGCTGAAAGCCAAGAGCAAGAACAGGTGAAGAGTGT
GGGTAGTGAGCGTCGTAAGCGCCGTACGAAGAAGGTGAAATACGTGGAGGACGACGACGTCTCGGAGGGGGAAGAAGCCGCAATTGCAGACAAGAAAAAG
CGCGCACAGCAACTCGACTATCAGCTGCGAGCAGTACGTTCCGCCTGCGCTGTTGCTGGTGGTGCAAGTTGAAGTAGTGGGTCGATGTTCTTACTGATGC
ATGCTGCGGCTGTTTGTAGGATGTGGGGTATCCACAACTGGACCAGATTGTTGGACGACGCATGAATGAGTCGTCTGGGCTGGTTGAGTACTTGTGCAAG
TTCCTTGGCCGCTCGTACTTGCATCTATACTGGCTCACGTTCGATGAGTTGGAACTCTTCATTCCTGAAGGATACCAGAAGTTTCATCGTGTTCACGTGT
ACGATCGGAAATTGAGGCGCGATGGGTACCAACCACTTGATGAAGTGGACGACCTGGAGGCGAACAAGCTGACCGTAGAGAAGATTTTGAATCACAAAGT
CGACCCGGCAGACCACTTGGACGAGCAGATTGAAAAGCGTCGAAATCAATTGCCCTACGTGCCTAAATTCCCACGCGTGACAGATTACTTACTGATGGAT
AATGCTGACGTTCTGTCGGAGCGCATGACAGGCATCGCGACGAAATTGACGAAGGAACCCGGCGGTGATATCTTCAAGCACCCTGTAGATGTCGAAGAGA
TTCCTGACTACCTCAATTTCATCACAAATCCTATGGACCTCGGAACTATTCTCACTCGAATTGGTCGGGAAAGTTACTACATTGGACCATCGGCCTTGTC
ATTATTTGCCTCAGACGTGCGACTGGTGTTTCACAACTGCAAAAAGTACAATGCAGAGGGCTCAGATATCTGGCGAATTGCGGACGAGCTGTTACGATGC
TTTGAGAAGTGGCTGTATGATTGGATTCTTTCTCCGTCGGCGTGGCTGAAACTTCCACCTACAGGAGACTATGAGAAAGACCAACAATTGCAGAAACAAT
TTCGTGCAGAAGCCGAAGATTTTTACGACGTGTGGGCTCCCTGGCAAACAGGTTGTTGCGTGTGCGGAAATAATGACCACAGTGAGGAGCTCTTGCTCTG
TGATCGATGCGATGCTGAGGTTCACATGCATTGCGCCACTCCTAATATCACCAAGCTGCCCGAAGGGGAGTGGTTTTGTGGGTACTGTCGAGTGCGCACA
AAATTTATTGAGAAAATGGACAGAGCGAAGCAAAACACAGCTCAAAACAACTCAAAACTAGTTGAGACCGTTCCATCAGATGGTACAGCATGCCATGAAA
CCCCTACCGGTACTCCCAACGATGGCCACAAAGACGAGAAGACGGCAATGGTGCATATCCCGAACATTATTACGGAGCTGACCGGTGGAGATGGCAAATT
TAACAAGAAAACGTCAAAACGCAGTCCTAAAGGAGCCAGCGGATCAAAGAGCTTGGATTCAATCAACGCGAAAGATCGAGCTGCAACATTTTTCCTGGTC
AAGTGGGTTGGCCTGTCCGTTCGATTTTCAACGTGGGAGCGCCCGGAGGATATTGGTGACGATGAACAGATCCAGCGGTATTTCAAGTTCAGTCGCGTGC
CTAGTGCAAAAGAGATTCGCGAGTCCACCTGTCAGTTGCCGTGCTGCGCTAAACGACACCAGTATGCATTAGCTAGTAGCACGAGTGGAAAGAAGTGCTG
TGACAAAGATCGCTTTTGCACTTTGGGATTTGGACATGATGGCGGTTGTAGCCGTAGTATTAAAGCTGCTGGAGGGGTTTACGGAAGTGGGGCATATCAA
AAACTACACATGGCGGAGCAAGTGAAGGCACAACTTTTTGCATTTCACTGTTTGCTGAACAATCACACACCCGACAAAGATGTTCTCAAGCAGTGCGGTG
TTTATACAAACGCGTATGTGACCTCGAAGCAGTACCTGAAGAAACCCAAGACTGCCAAGGAGGACGATGATGAGGATTACTCGGATGAAGATGGGGAATC
GTCTGATGACGATGCTGACTTTGATGCTGAAATGGAATATGAGAACCGACCTGCTCTTTACCCAGGCATTCTTACCCTGGATAATGATGACGATGAAGAG
GATGAGGCTGGAGGCCACAAAAAGAAAGCAGATGAAGAGGTTGCTGAAATGCTCAGTTCAATGGTGGAGCACGTGGCTCTTGGATACCCAACCAAACTGG
AAACCGTCAGCGCTGAAGTTAGATATGACTCTACTTATCCAGCGACAGCTTTTGGTGCGCTTACAGCCTTCACAGAGTACTGCGTTATCCTGGGGCGGTC
GCCCTTCGGCCTTGGTATGCGTCTTGGTATCAGCAGCGCCAACAGTGTTTCGGTTTTGGGGTTCCAGATGTTGGCGAATGGTATGATCGGCCCTGCACAG
GCGTCGGGCGCCATCTTGATCGGTGACGTGCTTGTAGCTGTGAACAACATCTCGGTGGCCGGCCTTTCGTTTAAGGATGTCGTCGGATTAATTAGTGGGT
CCCCCAACAACATTCTATTCCACTTCCATTCCCCTCGACCGGCGTTCACGTACCCCCCGTACTGCCGAGCAAAGCAAGTAACGATGACTCGGGTAGAAGA
AGTTCCCGATGACCCAGTGCCAGAAAGCTCCAAATACGCAAACTACAGCTACAACAAGTATAAGCGGATGCTCAAAGTGGGAATTGCAGAGCCAGGAGTG
GCATCATCAGCTTCAACGCAGACGTTGATGCAGCATTCCAACTACATTGCGCCAAGCGGTCCTATGCAACATCTTTATGCGGGTGTCGTCGACAACAGCA
TTGATCCCCACGAGCACTTCGCTAGTTTCCTCCCGGAGCGCAGCAGCTCAACTGGAGGATCACACGGCAAGCGCGCAGGCACTCCTAACCATGGAGACGT
GAATGAGTTCGTGCCGTATGAGCAGTCACCAACTTACAAAGGTGGCCGCACGTTGCGTTCTTACCAGGTCGAAGGCTTGAACTGGATGGTTTCATGCATC
AAGGCCCAGCGATCCTGCATCTTAGCTGACGAGATGGGGCTGGGTAAGACGGTTCAAATCGTGTCACTTATTGAACACATGAGGTCGGAGGAGTCCGTTC
GCGGGCCATATTTGATTGTCGTTCCCCTCTCTACGATTCAACACTGGCGGCGTGAAATTGAAAGCTGGACCGATCTCAATGTATGTGTGTATCACGACAT
TGGAGATCGCACGACCAAGTTTACTGCTAAAGACATGCGGGCAGTTATCCGTGATCAGGAATGGTATTATCCGGGCTTGGGCAATTCAATCTTCAAGTTC
CACATCCTGCTGACGACGTTTGAGACTATTTTAGCGGATTTCGAAGAGTTTGAGCACATTCATTGGCGCTTGGTGGTGGTGGATGAGGCACACCGATTGA
AGAGTGCTGGATCTCGGGTGCTGAAGATGATGCGTGTGCTCCATGTTGATCGCAAGATATTACTGACAGGTACGCCTTTGCAAAACAACACACAGGAACT
CTGGGTTTTGCTAAACTACCTGGAGCCAGTTAAGTTCGCAAGCCTAGAAGACTTCAACGCGAACTTTGGAAAGCTGCATTCACAGGAGCAAGTCGTCAAA
CTTCAGCAGTTGTTAGCTCCATACATTTTGAGACGCGTCAAGGAAGATGTCGAAAAAAGCATCCCGCCGAAGGAAGAAACAATTATCTCTGTGGAGCTGA
CGACTTTGCAGAAGCAGTATTACAGAGCTATCTACGACAAGAATAAGAGCTTCTTGTACCGTGGCACCAAGAATGGCTTACCCACGCTAAACAACATTCA
GCTTCAATTGCGCAAGTGCTGCAATCACCCGTTCCTCATTAAGGGCGTCGAAGAGCGAGAACTAGAAGAACTTGGCGACCGCCCTACACCAGCACAAGTG
ATGGAAAAGACAATTGAGTGCTCTGGCAAAATGGTGCTTGTATCGAAATTGATGCCCAAGTTGAAGCGGGATGGCCACAAGATTTTGATTTTCAGCCAGT
TCCTGAAGCAGTTAGATTTGCTGGAGCGCTACTGTGAAGCGAACTCGTTCGTTTATGAGCGTTTGGACGGCTCTACCAGCGGAAGCGTTCGTCAGAGTGC
GATCGACCGCTTTTCTAGACCACACTCGAAATCTTTTGTGTTTTTGCTGAGCACGAAAGCTGGTGGTGTAGGCATCAACCTCATTGCAGCTGACACAGTG
ATTATCTTTGACAGTGACTGGAACCCGATGAATGACTTGCAGGCTCAATCGCGTTGCCACCGTATCGGTCAGAAAAAGAGTGTACAAATCTATCGCCTGG
TGACCCGCAACACTTACGAAAGCGAAATGTTTGATCGCGCGTCGCAAAAGCTTGGACTAGAACATGCGGTGCTGGGTACGGCATCCTTCAGTGAGAGTTC
ACAGATCGCAAAGCCGTCAGCAGATCAGCTCGTAGAGTTGCTGAAGCGCGGAGCATATGCGCTGATGGAGGAGGACGATACTGCGTCTAAAGAGTTTGCT
GACCGTGATATTGAGACCATTTTGAAAGAAAATGCGCGTGTCATGGTGGTAGGGGGCGCATCCAAGGGTACTGACGGCGATACGGCGGGCATGGCGTCTC
CAAGACAGAAGAGGTCGCCAATGGCGTCACGAAAGCGGAAGTCACTCGGCGGTATGGCAGTAGATCGTTCGTCCTTTGTAGCTGAGGGGTCGACTGGGGA
GCTTTCAGTTGACGACCCGAACTTCTGGGAAAAAGTTCTTCCCGGGGCCGTGTCGGTAGAGATGCTGAGTCTGAAGCTGGAAGATGGTAGCGCCTTGAAT
TCTCGCCAGTCAAAGATCAAGTTTATCAGCAACTTGGACATTGCTCTCACCAGTCTTGTTGCCGAGATGAGTTCAAGCAACAATTCTGACGATGGCCGTG
TGGGTGGTCGAGATATCCAACACGAATACGACATTGCCATTCAGGTGTTGAGTACTGTGAGCTCGAAATGCCGAGACGAATTTTCCAACGAACAGATTGA
TCTTGTCAAGGGATATTTATCGAAGCTGGAGAAGTCACGTGTGCGAAGCTGTCGACTACAACCGTCGCGGACGAATATGTACCAGTATGAAGACTTTGAT
ACCCCGAAGAAGAAACGGAAACGGAGAAGCACACCATCGGGTAGCAGAGCTGCAAGCACCGATGATGAAGCCTACGGCGACACCCCTGTCAAGAAGAAAG
GAAGCAGACAGCGCGGGCGCCCTCCAAAACATCCGGGTACCGACGGCAACGCGAAGCCCCCGACTGCTCTTTTCCAAGCTGGTGCCATTAACGACAGTGA
TGACTTGTGTACTCTTTGCGGTGACGGCGGTCTGATTTTGCTTTGCGATGGTCCGTGCCACCGCTCGTTCCATCTCGAGTGTGTAGGTATGAAAGACGAG
CCGAACGACGAGCAATGGCTGTGCCCAGATTGCGCTGAAGGACGTCACATGTGCTTGATTTGCAAGCAAGTCGGTGAAATGGGCGTCGAGTTTGGAGTTA
CGCAATGCTCAGTAGCCAAATGTGGTAGGTTTTACCATAAGGGCTGCCTAGCAAAGAACTCGCGCGTGGAGTGGGTGGGCAAGAAGCGATTCCGTTGCCC
GAGTCATTTTTGCCATGCCTGCTCGCAGAAAGAAAGTGCCGCCAAAAGCGAGAAGAAAAGTGATGCCAATATGGCTGTTGTGAGCTGCATCCACTGCTCA
CAAGCCTTCCACCCAGATTGCATCCCATCATCAGACAAGTTTATTCGGTTATCGAAGAACCTGATGATTTGTGCGAGCCATTTAGTCGGAATGAAACCAC
CCCAAGCTGCCGCTGGAAACATGACTGAGCCTCGATCAACACATCGCGCTGGCGCAGCACTCGCTGCAGCAGCCGCTCAGCAACGATTAGAAGTTCCCGA
GGAGATTCCACTTGACAAGGAAGATGAGAAGTCGAATGGCAAGCGCAAGCGTGCACCATCCCTGAAAAGGGCAAGTACTTCTGGGTCGAAGAAAAGCAAA
TCGTATTCATCGGACGCACCAGGCAAGTCCAAGTCTACGCAGCCCAAAGTTTGTGCGTTATGCCACCGCGGGAACGTTATGGGAGGGGGTACTGATGGTC
AAGGCTCGTTGCAACTTGCGCCGTCAGCCAAAAAGGGAGCAACAACTGGTGCAAGCGCCGACTCGACGGGTGCTGCAACTGCTGACATGGCTCTTGAGGG
ACCGTTCATCGAGGCTCCAGTTCGTTTGAAATATGCCGAGAAGCCCAACGAGTCCGTGCATGTGCATTTGAACTGTGCTGTGCACTCGCCTGAGGTGTAC
GTGAAAGCTGATGGTCTCATCATGAACTTGCCCAAGGCTATCAAGCGCGGGCGACAACTCAAATGTACCAGTTGCCACAAGTTTGGTGCTACCGTGGGAT
GCGTCGTGGCTAAATGCCGACGCAATTACCACTTGCGTTGTGCTGTAGAGAGTGGCGGCGAGATCGACGGCACTACGTACGCATTGTACTGCAAGCCGCA
TGCTGCTGCGCGGAAGGAACCGACGCGTGTATGCGTGTGTGATGCCAACGATGAGCAGGACCCGGCGCTCACACTGGTATGCTCGTCGTGCAGCACCAAG
TTTCACCCTAAGTGCGTTCAGATGTCTGAGCGCCACGCAGCCCGTAAAGGTAAGATGTGGGTCTGTAGCGTCTGCGATGGCTCGGCTGCTGCAAAGCCGC
AGACGCCTACCCACGTGCCCGCTACCAAGACGAAGTCAGCAGCTCCAGCATCAAAGAAGGCGGTGGCTAAGCCCAAGTCGATCAGTTCGAAGGATTCTGC
TACGAAGATTGCGAAGGCGACGTCAAAGAAGACGAGCAACGTCAAGGCGGACAGCGTCGGTACTGGCGATGACGAATCGGCCTCTACACCGAAACGAAAG
AAGCCGAAGAAGAATCGCTTGAGTATGCCCCGGAATAAGTCTCGCCCCAAGGCGAACGGCACGCCCCACACGATTTCGCCGCACATGGACGCCGACTCGG
ACAGCGACGTCTCCACGGACGAGTAGGTAGGCAAGGAATATATGGCA