Description :
From Genome Similarity Track
Location :
Scaffold_146:36633- 42809
Transcript NameFunction/comments
Physo_143634VIP2
Physo_143635hypothetical protein

Sequence
6176 bases(100 bases per row)
CTCCTTACCTTCAGGCTTCGCGCTGGACACTTCATCACCAGCATTCAAGAGTGAGATGCTGGAGTTTGGCGACAAGGCAGAGCAAATGCGCTTGCCTTCT
TGAAGACACATGGCTCCTCAGCAGTCGTGACTGGTACGGAGTTGAAGGCATTTGGCGATATTGTTGATCCTACGCCGCCTGCAGCGTTGCCAGCGTTCAT
CCGACTAAAGCCTGCGCGAGAATGACCTGTATTTGCAGCACCCAGCAAAGCCGACCGATAAACACGAAGTTAAAGCATTCTTATAGCATAACACACCTTA
CACATAACACCTCAGCATTGATGAATACAGGCAACAACAGCAGCAAAACTCTTCGTGTATTTACTTAGACTACACATAACACTGCACAAACATAATGTTA
GAATAGATATCCACCCGAGCAACAGCGTTCTTACCTTGCATCTTGTTGGCATCATGAGCAGAACCGCCCTCCGCGTCACTGCAGCTGCTGGCCTTGGGGG
CCGTCACCCCGCCCGAGGCCATGCACTCGTCCGTATCGCCGCCGACACCGCTGTCCGCTATGTGTGTGGCCGCTGTATGTCTGGCTCCAAAATGCGGAAT
GAATGAATATTACTCAGTTGGAGTTGTCACTAAAATTGAAATAACTGTCGTTAAAGTGGATTGACCGAGTACCGGTTGGACACCGTGGTTGGACAGTTGG
AATTTGACGGTATGGACAACGAGCTGGTAGCCTGCACCAGTAACCCTTTGGAGCGCTTTGACCATGTTATCAACACGAGCGAGGGTTTCGGCCAGATTCT
ATTTCCGTACTTCTTGGGATTTAGGTTTGGATTATATGCTGCGGGAATCGCTCCAGTGACGGTTTGGCATGAGGTTTTCCTGCGGGTCCATGAATCAGTA
AACCACGTTACATGTACAGAAAATACCCTTGGTAGTCATGGCGTCGGGAAGCCACTTTTCTTCCTAGGTGAGGGTATTCCTGTCATGAGGTGTGCCGTAC
GTGTGGTACAGTCGCTGTACTACCTATATGATACACTTAAAGCAGCCTTTCACGCTCATCATTCGTAGTGTCGGCGGTTGCAAGCATGTCGGACCAGACC
AACCATTCATGCTGGCCAGCCACGACATTTGTTGCCGCCAGCAACCGATGCGACCCTCAAACACCATTAGCTCAATTTCAGAGTCACAGCTTGCCCCAAA
TGCCTTCTCACCTCAATTCTAAGTTCCAGCCCAAGTCATCTCGGGTATCGTTCACCAACGCTCAGCGCCTCCGGATTTGTGAGCACCAAGCTCGGAACCC
TCACCTGTCGCAAAACCAACTTGATGAGTACCTTCTCGCTCTCTCAGCTTCCATCACAGGGGGTGATCTCCAAGCTTCTCAAGCGCAAAGAAGACCCGAA
GAAGCTGCCGACCGCACAGCTCATCGTCAAAGCTCGGCATGAAGTGCGCTTTCCCGAGCTGATACCGCGCTAGCAAACTGGGTGTGTTGGCGTAAGAATA
GAAATGTCACGGTTACGGGTGATGCTATCCGAGAGAAGGCCGCACGGTTCGCGCGGATCCCGAAGCTGGAAAACCGACTCACGTGGTCCAACGGGTGGCT
TCACCGGTTTAATATTCGCCACAGGTTTGGCAGTGTTAAGCTCCACGGCGAGAGAGCCCGCCATTAAGGCGTTTATTAGCGACCTACAGCGAGAACTGAA
AAACTACGTGCTGCGAGACATATTTAACATGGATGACCGGACTCTTTTTCTCCATGCCCCCCCCCCCCGATCGCACTTTGGCTCGGAAGTCGGAAGCGTC
TCTTCGGCAAGGAAACCAAAACACGCATGGCTATCGCGTTGACATGCAACGCGGACGGTACGGAGCGCCTCCCTCCGCTATTCGTCGGGAAGTCGAAGAA
GCCCCGAGGCTTTAAGAAGGACATGGCAGTGGGCATTGGAGCTGAACTACACGAACAGCGTGAAGATGTGGATGTCGCGCGCAATCTTCTCAAAGTGGCT
CAAGGATGTCGGCACCAAGTTCCGACTGCAGCATCGGAAGGTTCTTACGATCCTGGATAACGCTACGGTGCACGGAAGCTACGACGCCGACTCCCTGACG
AATGTTGAGGTGGTTTCCTCCCACCCAACACGACCACTGCTTGACGCGGGGATAATTGCCGCGTTCAAGCGTCGGTACAGGCGCAGGCAAATTCAACACG
CCCTCGATCTCCTTGAAGCCGATCCAACGATGGACATATCGAAGGCGGCCAAGTTGTACAAGGTGGACATTTACCAGGTAATTATTTTGTGCATTGAGTG
CTGAAACTCCATGCCTCCCTCTCTTTTTGCGAAGTGTTGGGGACACACCGTACTTTTGGACAACTACATGTGCGAGTGTGACGAGCCTGAAAAGGACGAC
TCGATCGCCGACGAGCTGAGCTCGATGCTATCGAGCTTACGAGCGTCAAACCCGATGTCCGTGGAGGAGTTGCTTAACCCTATTGTGGTTGATGGTCCTA
AAACCTTGCAATATGCTTGGTTTTACAAATTTAATCCAATAAAATCACCCCTCTATTGATGTTAACCTATTATATCACTTGCGTAAAACCAAGCATATTG
CAAGGTTTTACAACAATAATTGCAATAATTATTGATACACCCCTGCAAAATGATATATTATGCTGCGGGGTGCGGCGCAAAACCAAGCATTTATGCATGT
TTTACCATGGGGACTTCAGTATACAAAACTCAAATATAATTTTGAACACTAAAGGGTTAACCCGCCACATGAGGACATTATCGACAAACCCACAGATGGA
GAGTTTTGCGGTATTGACGAAGACAAAAACCCACCTTTTGAAGACGAAAGTGGCGCAATTGTGGTCGTTGATGATGAGCCTGAGACCACTAAAGAGGAGC
TGGGCGTTGAAGCATCTAAGGTGGATCGCCAAAATCCTCACTAGAGCAGATGCAACAGGCGTCTCCGACAGCTCTGTGAGCGGGCTCAGAACAATGCAGG
CGAAGAGCTTGGAAGAAAGCAAGGATACAAGCAGCAAATGCCTTTGCTTGACTACTTTGTTAGTCCTGTACAGAATGAAATGTTGCTATAGTTAAACACC
CCATAATATTCATATCTTGTGTTTTTGCATTCCTTATTACGATTGAAGGGTGAGGGGGGATAATTTCTTGGCTTTGAATAGGAAGGTCATCCTGAATTCG
TTGGGACCCGCAATTTTATTCCTGATGAGCGGTTATTCCTCACCTAGGGATTACTACCGAGGAATTGTCTGTACCGCAATAACACCACAAGAAATGTATG
TAAAGCGTACTGCAATAGCAACTACAAAAAACACCGAACTGCCCGCGAACCAGTATTGATGATAATAGTGGCGGTTTGTCATGAGGTTTTGAGTTTACCT
AACGTGATTTACCAATTCATGAACCGGCCGAAAATGTGGTGTCCCAGATTAAGTGATGTGCCGGAAAAACTGCGCCTTTTGGCGGCTTGTCCCATCAAAC
TGCTGCGATCTTTCCGACATGGTGTTGAAAACAAACCACCAAATTTTCGGCGCGCAACTTTACTTGCGCGAGTTAAAGTTGCTTGATATGTGCACCACAC
CGCTGGGGGGATCACCCCAGAAACGCCACACACAGTGAAGCAGGCCTGAGCCGAAGCGAAGCGCTCCTCTCTCTCTCCCTGCCTCGCGCTCGTCGGCCAT
GATCGACCCGTCCAAAGACAAGTTCGCCTACTTCAAGGACAACATCCAGACGGCGGAGGACAAGGTGCGGCCTAAATGGGACTCCGGAGTAAGATAAAAC
ACCAGCTAATCCTTACTACTACTGCTGCTGCTGCTGCCGCTGTGGCTACTATACTACCAGGAGGACTTCGACGCCAGCCAGTACTACTACCACCGAGACG
AGTTCGCGGGCTCCAAGCCGCTGGGCGCCAGCAACGGCCTGGGCGGCAGCGGCGGCCCGCACCTGAGTCTCTCGTCCTTCCACTCCATGGGCAGCGGCCT
GGGGGCGGCCATGGACGCGGAGGCGCCGGAGCCCAACCTGGCGCAGATGCACGGCTCGTACGCGGGCTACAACAGCGCCATGATGCAGGGAGGAGGAGCC
AGCTCGGTACGGCACGCGGCAGTTGGCCGGGAGGTGGCTGGGAGTTTTGAACTAATTTTTGTTGGTGCTGGCAGTTTTTGGGCGGCTCGGGCGTGGGACG
CATGCAAGTGGGAGGCGCGGCGATGCCGCCGACGCACGAGCTGCACCGCATCAACTCCGGTGAGCTCGGAGCGAGCTAGAGTTGCTGCTGGAGTTAAGAG
TGTCATGACTGACTGGGTGGGGGTTAACTGCTGCTTCAGGACGGAATTTCCAGCTGCCGACGGAGAACAAGGCGCCCGACATGTCAGAGTTCCCTGCTCT
CGGATCCAGGTGAGTTCAACTGTGCTGGGAACTGAAGACAGGCAGGAGGGACTAAAAGCCTCGGTGGTTGAGCAGGATGGGCTCGCTGTCGCTGGAGTCG
AGCTTCGAAGGCACGGCGGCCGACCGCATGCGCGGGCAGCCGTCTGAGTTCGTGATCCAGAAGGAGGACTTCCCAGCGCTCTCGACGTTTGGTGGGCCCG
GGGTTAGCGAGAAGAGCCCCATGCGGCCACCGACCGAGCTCAAGAGACACTCGAGCTTCACCTCAAGCGCAGCGGACGGGATGGTGTCCTCACGGTTGGA
GCAGCAGAAGGGCGGCACTTCCATAGGCAGTCGGGCTGGCAGCGCGGCGCAGGCAGCAGCGAGCAGTGGCAGCGTAAATCTAGGCACTGAGGCGTTCGAT
CATTTCCGAGCGCCCCGGCCAGACGAGCAGGCAGCCACGAGCGAAACGAGCAATGGTGAACTGGACCCGAGCAATCAGTACGGGCTCCTGGGGATGCTGC
ACACCATCATCCGGCCGGGCAACGACTCCAAGAAGAACTTGGCAATGGGCTGCGACCTGACGTCGCTTGGATTGAACCTCAACGCTGCAGAGTAAGTTCT
TGGGCAGGTTCAGCGGAGGCTGTTGATGATACGAGGCTAACTAATTCTGTGGCTGGCTGTTATCTCCAGGCCGCTGTACCCTACGTTCGCATCTCCCTGG
TCTGAAGAGCAGCTGACAAAAGAACCGCAGTTCTCGTTGCCAACGTGCTACTACAACCAGCCGCCGGTGCTCAAGACGACGCATCTGTCCAAGTTCCACC
TCGAGACGCTGTTCTTCATCTACTACTCGATGCCCAAGGATGTTTTGCAGGCGTACGCGGCGCAGGAGCTCTACAGTCGCGAGTGGCGCTACCACGCTGA
GTTGAAGACCTGGTTGAAGCGCGCCTCTCCTGCAGATGCTGCTCTTCTGACGGGTAATGCCAACTCTTCGGTAGGGGGGTCAAGCAGCGGGTCTCCTACT
GGCAATGGTAGCATCGGTTCCATTGGTAGTGCGATGGGCTCGGGCACGGGGCCGTCATTAGCGAACAGCTCGCTTGCGCCGCAGTTCCTGTACTTTGACA
CTGCGACGTGGGAGCGACGCGTATTCACGGGCAACATCAACTCGATCAGTGCTGGCCTTTTGGGCGAAGAGGAGATCCGGGTGAAGTTTAACGCGTCTTC
GTAATATACTACGCACCTCGACCACCAGTTCTGCGGCTCTGGGATGATGTGCTCGTTCACTTGGTGAAAGGCAATGGAGGCGTGCATCCAGGTGGCAAGG
CTGTGCTGTTTATATTGTATTCTATAGTTCATGGGATCCTCATCACTCTCAGCTTATGATGTTTTGCTGTGAAGCGTGTTAGGGATGCCAGGAGAGAGCG
GAGAGCAGAGCAGATTGCCCAGGTAGACCTTCGATCGTCTACATGCAGCGCACTGATGCTTCTCCTCTCTCTGTTCTATTGTGTCATTTTGATGCCTGCC
TGTTCATGCAGATTCCTTCCTGCCTGGCCCCCAGTCGTGTGCATTTCCTGCTTCATCGCAGTATGCGGAGGCTGCACATACACCACTTATAAGAATTTTT
AAATCACGGGCGCTCGTGTCTGTTGGTGGGCGCCACCTCTCGACGTGCGATCACCGAGAGGAGGCATCCACGATCTGCTTGCCGCCGAGAGCAAGCTCCA
GCTGCGTGAGACGCTCTTGCTGCGCCTGCATACATGCCAGGAGCTCCTGCTTTTCGGCCTGCAGCTTCTCCACCTG