Description :
From Genome Similarity Track
Location :
Scaffold_49:36630- 99895
Transcript NameFunction/comments
Phyta_totarag2172conserved hypothetical protein
Phyta_totarag2173hypothetical protein PHYSODRAFT_346958
Phyta_totarag2174hypothetical protein PHYSODRAFT_346958
Phyta_totarag2175hypothetical protein PHYSODRAFT_546922
Phyta_totarag2176U6 snRNA-associated Sm-like protein, putative
Phyta_totarag2177hypothetical protein PHYSODRAFT_512543
Phyta_totarag2178hypothetical protein PHYSODRAFT_334993
Phyta_totarag2179conserved hypothetical protein
Phyta_totarag2180hypothetical protein PHYSODRAFT_354953
Phyta_totarag2181hypothetical protein PHYSODRAFT_513915
Phyta_totarag2182hypothetical protein PHYSODRAFT_354952
Phyta_totarag2183conserved hypothetical protein
Phyta_totarag2184hypothetical protein
Phyta_totarag2185hypothetical protein PHYSODRAFT_302913
Phyta_totarag2186hypothetical protein PHYSODRAFT_460566
Phyta_totarag2187microtubule -associated protein EB1
Phyta_totarag2188hypothetical protein PHYSODRAFT_351861
Phyta_totarag2189hypothetical protein PHYSODRAFT_561976
Phyta_totarag2190hypothetical protein PHYSODRAFT_361180
Phyta_totarag2191sporangia induced hypothetical protein
Phyta_totarag2192choline-phosphate cytidylyltransferase B
Phyta_totarag2193hypothetical protein PHYSODRAFT_286562
Phyta_totarag2194choline-phosphate cytidylyltransferase B
Phyta_totarag2195hypothetical protein PITG_14592
Phyta_totarag2196hypothetical protein PHYSODRAFT_259266
Phyta_totarag2197hypothetical protein PHYSODRAFT_354949
Phyta_totarag2198hypothetical protein PHYSODRAFT_511517
Phyta_totarag2199transcription initiation factor IIB, putative
Phyta_totarag2200hypothetical protein PHYSODRAFT_286559
Phyta_totarag2201hypothetical protein
Phyta_totarag2202hypothetical protein
Phyta_totarag2203hypothetical protein PHYSODRAFT_561955
Phyta_totarag2204hypothetical protein PHYSODRAFT_512486
Phyta_totarag2205hypothetical protein PHYSODRAFT_439222
Phyta_totarag2206conserved hypothetical protein
Phyta_totarag2207carbohydrate-binding protein, putative
Phyta_totarag2208hypothetical protein PHYSODRAFT_354946

Sequence
63265 bases(100 bases per row)
GCAAATACCTGATGTCGCATCATTGGCCCTCCAGTCATTTTGGCAACAGACGACACTAAGCGACTAGGAATTGCGTCGCTCTCTCGGTCTCTAGACAAGT
CGGTGctctctccagctccgccatctACATATCACCAGCAAGCCCCGACGCTTGCAACCTTCTTCGTCCAAGAAACAGATTCAGGAACCAAGTATGGCGC
CCGCTAAACGATTGAATCTGAGCAAGTCACGCGACGAGAGCTCctcggcctcgtcctccgatGACGAacaggagaagcagcagacgacgcAAACGCCCGA
GGGGGAGGAGTCCAGCTCCGATGAAGAATCCGACGAGTACGTGGTCAAACGCTTCGGTCCTAGCGCCACCGCTGAATTATTCAGGTTatgacacacacac
actAACGATGTTGAAACATGATGCAGGGAGTTCGAGATCCCGCCGGGCTTCGAGAGCGTCAAGGGCAGCGGAGCTGTGACACGCGAGGCGGTTCTCAACA
ACGACCAGGAGCTCTGGTTCTTCAAGCTGCCCAAGAACGTACGTTGCTCGTTGCTGCGTAGCGGTCCGTCAGACAGGTCCGCAGTGATTGACGAGCTGTG
AATTGTTCTGTTACTGTAGCTGGACGCATCGGCGCTGGCCAACGTGACGATCAAAGTGGGTGAGGGCAAGACGGCGGTGACGTCCGGCGAGGTGCTAGCC
AACGTGACGGCCGGAgaggccaacaagaagtacctgctgcagagcgagGACCGCATGCTCACGGACCAGCTCGTGAACGCGCTGCCGCTCGCCTCGGACC
GTTCTCGCTTTGTACTGGGCAAGCCGTTCTCGCGTTGTTTTTCTTTGGTGGAGGACCACGTTGACGTCTGGCCTGTAtcaaagaagaagtcgaccAAGGC
TGCCACTGCGTCGcccgtcgtggagaagcgcaagaaaaaGCACTCGACTGACAAGACCGTGAAgcacaagtcgaagaaggctAAGCACAAGAAGTAAATT
CCTCGCGACGGAAACAATAGCGCAGCACTCGATAGACACCCCACCCCATCCACGAAGAAATTCATCACCTATTTGTCATTTTGTTCTTCTCACTCGGTTC
GAAACATGCTGTTGGCTCAGTTTCGACCTCGCCACGAGATAGTACCTGCAAACGAAGAGGTGGTCGTCTAAATGAGCAGAAGCGGTTCTGCTGGCGGCGC
CTCCTGACGTTTGGAGCTCTTGTGCTTatccttcctcttcttcttgctcttctcgccATCGCCAACGTTCTtactggagctgctcttcttgtggCTACTG
CTTTTCTTCGCAGACGAGCTCCGATGATGGTGGCGACCCTCCTGCGCTTTAGCTggttcctgctcctcctcgctaAAGCCACCAATCAATAAATGCTCTT
CTTTCCGTGAGGGCTTCTTGGATTTGGAGCTCTTGGATGAAGACtccttctttttcttcttacCGTCATCCTCGCCACAGGAAGACTTCTTTTGCTTTGA
GCTTCTCTTTTTGgacttcttctcctctttcGCCGGCTTGGCGGACGGCGTCTGGCGATGGAACCACTGGTCCGTGGGAACCTTCTCGTCTTCGCCCAGA
GGGGTACTCAAATCTACTGCGGCCAAATCGGTCTCCTACAAGATAACACAATTGTGTGAGGATTAGTGAGCCAAGCTAATAGCTGAAGTGCGTCGGCCAT
CTTGTAAGTGACTTACATCTTCACCCACTGAACCGCGTTTCTTTCGAGAGCGCCGGCGGTCCTCATCACTAGAACGAGCACCGTCAGGCATCAACTCATC
CTCGAGAATAGCACGAGACTTCGACTTCTGAAAAGCACCAAAGTCAATATGGAAGTGTAAGCAACTCATGGTGCGAAACACGAGCATAACTGCATCGCAC
CTTtgacgccttcttcttcttgccgttcgTGGCGGAGCCCAAAGCGCCCATCATATCCGCAAAGCCCTGTTCAATCAAAAACACAGTCATTAGCGAGGTG
CTGCGTAAGTAGCAACTTTGCACTCGTTTTTCATACCGCGTTGGCTCCAGCATCAGCAGAAGCTTGTGAAACGGCAGATAGGTAGAAGGGGTCCTTGCGC
AGTCGCTCTTGCTCACGCGCATATTCACGTTCCTTTCTTTCTTTCTCATCGGCGGAGTATTCTGATTCCGATTTTGAAGTTGACtcggaagaggaggagc
cgtggtgacgacggtgacggTGACGGTTGTGCTTGTGCCCCGGCTTCCGCTCAGGCGAGCCATCGTCAATGCCACTGTagccgccaccaacaccagcgtG
ACCCTGGCTAACGAAAGAGACTTCAAGATCATCCTCACTTGAAAATGCAGACACGTCACCGCCTGATTCGAGGAACTTTGCCTCCGAATTACTCAAAGGT
TCGTCAAGGTCCAGATCACCAGGTAGTGGCACCTTGCGCTGTGCCTTGACACCAACGGGGGCTAATCGCTCGGCAAAGTACGAGTTCAGCACATCAAGTC
GCTTTGCCGGATCAAGAGAGGCACTGCCATCAAACGCTCGTTCGGTACGCTCTTGTGCGGTAAGTGCCCCGAGTCCCATACTCAATGCaagcaagagctg
ctgcagacacaCGGCGCGCTCTTGCACCTCAATATACTCGCTTTGAACGAAAGCTGGCAGGCGCTCCATGATAACCGTGGCAATGCGCTCCACAGTGGCA
TCATCAGCGCGTTCGGCCATGGCAGTGAGAATCTTCAGCAGTGCCTGAATGAAGACAGTCTGAACGTGGTCAGGCAACGTAGTCGTTCGAGGTTGAAGCA
TCTCATCAGCAAGACCttccagtcgctggagcttctcctcctctgtttctcgctcttcgtcttcgtcgtcttcctcatcttcctcatcatcCACGTCATC
CAAAAACTCCATCACATACTCACCCGTGATCCAGGCCGCTGCATAGTACACCTCCTGGAGAGTGCCCGCTCCAGGACCACTGAGCGCCTCTTTTTCCATC
AGCAGCTGAATCATGTTGTCCACCATAACGCTACGCACGCTCTTCACACGAACCGCAATGTCCACAAGCTGGCGCGCTACCTCCACACCATGCGAGCGCT
TCGCTGGTTCGTCATCCGTCACCTTCATCTTGGTACTGCTACTACTAGAGCCAAGCATGCTGCCCGACGACTgtgccagcgacgacagcgacgcatCAAC
CGTAGCGGCGGTGTTTCCTGGCACGCGAgcaagctgcaccagcacgtgaatATACCAGTCAAAGTCGTGAATATTGGCGTACTTGCTGACCGAACAAACA
TGCAAGATGTGAGTGATGAGTTCATGGCGGTAAGCACCGTCGGCGCTCAGTGTCTGGCGCATGAGCTCACGGATGATTGGCGCCGCGTTGTCCGGATTTA
CCATGCCGGACAACAATTCCAGCGCGCGCATGCGAATCGTAATATCGTCCACAGCGAGACACTCGACAATCAGCTCCTGGTGCTCCGTGACCACGTACGG
GTGCGACTTCATCAAGTTGCCCAGCCCAACAAGACCCAAGTAGCGCAGGTTCTGGTCCGGATCTTCAATGTAGCGGCGCAGGTGATCATTACAGAGTCGG
ACAACCGCTGCCACATTGCGCGGCTGTGATccgtcgctcttcttggtgtacagcagcgccgtcgtgaCCGTGCTGATGCACTCGTAGagcagcgacttgg
ccgGCGTGTTCTGAATCACCGTCGCGAGTggatccagcagcttccggGCAAGACGAGGCTCTTCCGGCACCAGGCTGGCCAGCAACTTGACGACCTTAAT
GAGCATCCAGTTGTTGGAGGACGTGGTGAGCAGGCGGAAGAACTGCGGGGCCAGCCCCAAGTAGTTCTTGGGCTTCTTATTAGCCAACTCACAGATGACG
TTAACCGCACACGAGACGACTGTGACGTCGGGCTCCTCCATCCTCTCCTTGAGTCTGTCGAACGACAGCCGCAGCCCTTGCGGGTAGCGCAGGAACATCT
TGTACAGCACGAGCGTGGCTTTCTTCCGGACGTACGGCTTGGGGGAGCCCATCATGGCCAAGACGTCGCCCAGCAGATCTCTGGCCAAGTCCGTCGTGAC
GATGTTGGCCAGCACGTTGATGGCCAAGCCCACCTCATAATCGCTTGTGCTGCCgaactccttcttgagcaggttcgtgcacagcagcaccacgtccgtG
GACTGCGTGAAGCTCTGGCACGCGGCGTTGTAGCCGATGCGCTTGTGCGCGAACCGCTCGTAGCTcatgacctccaccacgtggaAGGCGGCCCAGCACA
TGTCGTAGCCCAGCATGTGCAGGTACGTGAGCTTGCGCACGGCCTGCGCCTTGACGAACGCGTCGGTGCTGCGCAGCTCCGCCTTgatctcctgcagcgc
ctgcgaGATGTAGACAGTCACGTCGCCCTTGGTCGAGCGGATGCCCTTCACCAGATCCTGCAAAGTCTTCTCGAACATGATTGcgcagcgctggacgacg
gtggagctgaGACGCGAGGCTGCGAACTACCGGCAGCGGACGGGGGACGCCAAGCGCCGATGCGAATCAAGAGTTAAAGTCGGATCGCAACGTGAAGGGG
GGAATGAAAGTAGAACCCGGGTCGATGATTTGACTTGATGTTTGTAAGCAAAACGGGTTTCGACCCGAAATCTTTCCGTGATCAGATGTGTATGTAGGAC
ACCACGTAGTAGAATGAACTTGACTGCTTTACCGGTGGCGTGGATAGAGGAGAGTATGATACGATGCAGACAGctagagagagagagcatTGTAATGCAA
TGGCATGACATGGTGCAATTGCTGGAAGCATCGACTGGGCCTCGCAAAAGTGACACGAAAAACTGTAGCTGCTGTTGTAACTATTTATTATCTGCTGGCA
CTTGGCCTCGTGTAAGTAGACAGCTTCAGCCCATGACCAGCTCCAGTAGAATCATCAGCGTGTTAATGATCATGAGCGGAACTGCGGCAGGCGAACGGCA
AACGGCACGAAGACATCAGCATTAGAACACCACGGACAACACGCAACTCCAGCAAACAACGGTTGATAGAACAGCATACAGCACAGCCAACGGCCAGTAT
GACGACGTACATCGCAGATACTGCACGGCGATGAGGAAGCCCACGACCTGGTTCTTGATCGTCATGCCCTGCGACGAGTCCACCTTGTGCCAGCCATCTG
CAGGTCGTTGAAGAGTTATTATAGTCAATAAGGAGCCTCCAGTATATCCAAAACTGCTGCCAGACGCAGGACGTACGGGGACGCAGGAACCGCTTCTCGT
GCAGGATGCACACGGCGTTGGTGAGCAGCAGGCTCGTGAGCACGAAGTTCCACAGAACGCCCATCGGTGCGACAACAATTGACTGAAGACGTGGCGAAAA
TGAAGCTGACGTACCGAAAATAGTCGCACTAAATTCGGTATTCACCGAAAATAAGGTGCAACGGCTGCTCCGGCTTGTTGCGTCAATCCAGAGACACAGC
GAGATTGGCATCGATTGACAGACACCTCTGTCCGCCGACGTGATGGCTCGCAACCAGGTTTCCAGACGTCCGAGGCGGCGTGAGAGGGCGGCTGCATCGT
CACAAGCGAAGGAGGTCGAGAGTGCAACGCAGAACCCCAAGGAAAGCGAAGTCGGAATGCTGCCGCGTCTGCTCGTGCGCTTCGGTGTGGCTGCCGTCAT
TGTGGCGCTCGGTGTGCTGCTGATGACCTCGCAGCAACAGACGCCGACTCCGACTCCTAGTCGCAATTTGAGCCCCACAGAGGAAGTGAGAGTGGAGGCA
AGAGCTGAGCGCCGAGCTGCCGCACTCCCtgttgaagtgctggacaagtATCCGCACGACGCTGCGGCGTTCACGCAAGGCTTTACGGTTGTCAACCGAG
GCGGTGACAAGATCTTCATCGAGTCGACGGGGCTGTTTGGACAATCGAGTTTGCGGCACGTGGACATTGAAAGCGGAACAGTCTTGAAGCAATACGATCT
GCCCAAAGAGCTCTTCGGTGAGGGCGTGACGCTCGACCTGAAGGACGAATTGGTCATGCTGACGTGGAAGAGCAAGACCGGTCTCGTGTTCGACCTGGAT
GAGGCTGCGGACGGCAAGGTGGATGGCTTCACATTGAAGCGCGAATTCAATTATGATACTGTCACGGGCGAAGGCTGGGGCATCACTTACGACGGCAAAG
ACCTCGTGGTCTCGGACGGCTCATCGACCATCATGTTCTGGGAcccgtcgacgatgaaggaggTGCGGCGCGTTGACGTCACGATCTACGACGGCACGCA
GCAGATCTCCCAGatcaacgagctggaggtCGCCAAGGGGTTCATCTACGCGAACGTGTGGTATCAACCGTACATCTTGAAGATCGACCCCAACACTGGC
GCCGTTGTCACCATGTTCGACTTGTCAAAACTCGTCTCAGACGTTGGCGTTGACGTAACTTCGGGCGCCGTGCTCAACGGTATCGCCTACGATGATGCGG
AAGACGTGTTCTACGTCACGGGCAAGCTCTGGAATTCCGTCTACAAGGTCCGTCTCGTCGACCCCGTGCAGTAAACCCAAAACAATAGAGTGCGCTGTAC
GTAGCATCAGCACAGAGCAAGAAAGCACGAATATGGATCTCGGTATCTTATCTAGAATAAGCTTCTGTGTGCAACTTGAAAGTCTTGCTTGGacaccgct
gctgctccttgtTGCTCCTAGTCTGTGCTGCCTTGCTATccctcctgctgcaggaacggGTTGGGGATCTCGGCCGTGCCGTCCATGGGCGACACGAGCA
TGACCGACGTGCCTCTGCACACCACGAGACCGACCTTGCGCGTCTCGTCCGTGATCCGGTATTCGTCCTTCGGGTCGCGCAGGAATTCGACGcagtcgtc
cagcaccaggttcACCAGCTGGTCGTAACCCTTGAGCGTGCCCGTCACCTCGCGGCCGCCGTGGAATTTGACGCGCACCTCCTGGTCGATGTACTTGGCC
AGGTCCAGGATTGGGTCCTTGCGACTGCCGCCGCCACTTGCGCCATTCGCCGCCATCGTCTCTGTTGAATTGTATGGGAACGCTGTAGTGCCACTACAGT
AGTGGAGCTATCCACTGCTGCGATTGGTCGAAACTCGACACGTATCAGACAGAATCAGACAGAGCGGATCCATCTTCCATCATGAGCAGGAGCTTCTCGG
CggacgagcgcgtgctggaggccgTCGCGCAGACCAGCGCGCTGTCAGCCGAGAGTAAGGCGCTGTATTGAAGCCCGACAGCGACACAATATTTGCTGCG
TTGGGCTCATTGGAATATGTGAATTGGATGCAGACTTCGATGCGATGTGCAAGCTGGCGGTGCGGCTTTTTGGCTCGGACAAGCAGAGCAAGCGGCGATT
GACGCGCGCTGCATGTGGGTGCAAAGGGTACAACTGCAATCTAACCATAGGTGTTGATCGTACTAAACCGGCGTTgtttgtgttgctgctgctgcggtga
aTTGCAATCTGCAGCGGCTTCAGGGTGGGAGAGtgagcagatggagcaggCAGTGCTCGCCATCGCGAAGATCCTCATGGACGGCGCTAAGGTGTGTAGC
TATCCAGAATTGCAATGGAGGGATGATAGAGTTCTTAACTGATGCGTGGTGATTGTTTGCCTTTGTGCAGGCTGAAATATCAGAGCATGCCTTCCGGTTG
GTAGTGAAGGGGATGTCGCTACCGGAGCAGCATGTCGAAGTTCTTGCGCAGGTTGCGGCTTCTATTGGACGTTTAGGGGTCAATGGCAACGATGATTTCC
TGACTTGGTGGCTCTTTGTGCTTGCAGTTATATGAGGCGCACGCGAAACATATTCGAGAGTGCGTCACGAGGGAGACAGGCACAAGCGTTCCACACTATC
GCAATTTGGAGTGGCGAATCGACCTGGAGGTGAGATATTGTGTGGAATGATGGTGTCGTTCAAGGCACACCGAGCTCTAATGCTTTCTTCTGCAACACGA
CAGCTCGGCACGCGCTTCCACCGCAACAAGCCGAAGCCCATTGTGACGCTTCGTCTGGACACTGCCACCCAACCCAACAGCTCCGCTGTACCGCAGATTC
AGTCCACCTGTCTTCGCGTAGACTACGACGGTCTTAGACTGATGCAGCGTCAACTGGAGACCGCGTTGAAAGAGGCCGACTCCGTGCACTGCAGCCGAAT
CCAGCGGTACATGCAGTAAGAAGTCAGCAGGAACCGAAAAGAACGAGTATGCGCGTCTTCAACATCAACTGTCTGCGCTGCTGTTATTTCTCTTTCTTCC
GGTCGGCTAGATACTGCTCTTTTGTCTTGGTGAAGGCCGTGACCtggtccagctgctgcttcgactcGTTGGAAATGCCgtccttctgcagcagcagctc
cgcaaACTTGGCCTGCTTCTTTTTTCTGGTCTCCAAGTCCGGTTTAATCTTCGCTTCCTGCTCGGCAACCCGTGCAACAAGCAGGTTATTTATTGTCAAC
GCCTTGTTGACTGCGCCAGTCTCTCGAGAGTAACGAGCTCCGCAAAAGCAGATTTCTTCTGGCTGATATCAGGCCTTACGTACCACGTCGCGACGGATCT
CCTCGTCAGATTTGGGGTCCCAGTAGGCGTAGCACAGCGCGATGGGGATGCCAAAGCGCAGCGTGTAGTCGATCATCATCTTGGGCACCTTCATGGCCGC
AACACAGGCTCCACAATTCGAATGCGAACTTAAAGCGCACTTAAGCTGTAGCAGCCGCACATTTTGATAGACCAGCGTCATgcgagcagctgcgacggCG
AGGAACCTGCACGGTGCGGCTCGACATGCTCTCCAGGCATCCACTGGTACTGCCCGATGCTTGAGCTCTACAGTTACTACACTGCCTGAGGGTCTTCGGG
AAATCTCCAGCGTCCCGCGCACTCCGTCCTGGTCGCTCAAGGAGCTTCACCAGGAAGGAGCTCAGCTCAATGCCGCGGATACTGTGCTGAccgaggagaa
ggtgcgcAGCAATACACTTTGGATTGCTGCGGTTGAGAGCTGACTTATGTGTCTGATAGCTTCGTGAGTTGGCGGAGCTGTGCCATCTGCacgtggagga
cgagaagctccCGGGGATGCTCAAGGACGTAGAGTCCATCATCCAATGCACCAAGACCATCCAGGCCATGACGCTCAACGAGAACATCGACGATATGTAC
GCTAAGAGAGACTTCGATGCTGGTACGTGTAGTTGGGatttcgtggtgctggagttgatATCTTACACCTCCGTTTGTTGTCCGCGCCTCGTGCGTCAAC
TATCTCAGGTGTTGTGGCCCCTCTCCGAGACGACGTCGTCACAGCAGGAGACTGCGCAGAGAAGGTGTTGGCGAACGCTGCAGAGAAGTCTGGCTACTAC
TTCAAGGTCcccaaggtgctgcaggactAGATCATGTGAGGCATTGGCAATAATAGAGGAAAGCGACATTGTGCTAGGCGAAATCTATAGTAAATGCAGA
TGGGAAGCGTCTTCTCCTACGGAGTCTACCCTCGAAAGAATCATTCGATCGCCTTGAAGACGTTGGCCTTGGCCAGGTACTCCTCCAAATCTGCAACGAA
CAGTAAACAATTCAACCCACGTCAGTACCAACTCCATAAGATCAACCCACACGttaagaaaaaaaaacacttcagcgtcgtcgctcacCTTCGACCTTCA
TGTCGAGGCCGTTGAGCTTGCGGATGCCCAGGAGCTGATTCTGGAGCGAGCCCTTGTGATACATGAAGAGCGTGGGGCAATTCCGCGACGGCCAGTTCTC
GATGCAGGCCTGGGCCTGGATGCTCACGAACTTCACGTCGcggtgcttcttggccacctcgcgcagcacgTGGTCCATGACCTTGCACTCCTCGAGCGCC
TCGTCCCAGAGGTAGGCGATGACCCAGTGCTCGTTACTGCCGTCCGTCACCTCCTTGGTCCActcgtccttggcgatgGGGTGCACGTCGCCGAACTTGT
TGCGCGACGCCTGCGCCATCATCTCTTGGATGCGGCGCTCGCGGATGCGTGCCAGctccgtgtcgtcgtcgtagtcgtcctccatctcgtccagctcatC
CAGCGTGGCGTTCTCACGCGGATCCAcctgctcctcttcctcctgaTCCTCCTCAGCGGGCACCTTCGTCTTGGGCGCGAGGATGCCCTTCTTCACCAGG
ATGTCCTCCCACTCGGTCGTCTCGCCCGTAGGCGCGTAGTAAACGTTGCCGCGGTCACCCatggtcgtcgtcttctgggTACGTGTTTTCCAGAATGTGT
CGAAATGACGATCGGTCATTTTCGGGCTTATATTCGGAGCTCCACTTAAATACGACTCTTATTTTCGGGTCCTAAAATGGCGGGAAGCTCATTCTAGCTT
CGATCGCGCCGAAACCATGGAGAccatgaaggagctggccgTGAACGTGAACGGCAAAGGCGCCATGCAGctggtgacgacgctgcGGACCATGAAGGAC
GGTCAGGTGCCTGCGAGTCGAGACGTGGTCTTCACCAGTGGAGAGGACGGCGTGCTGTTCGTGACGGACCTGGCGACCGAGAGCTCCGTGTACCAGACCG
AAGTGTGCGATGGCTTCGTGCCGTCCTTCGCCGTGACGCCCGAGCAGAGCCACGTGCTCATCgtctcggacgacgacagcaatgTGGCGTCCTACAGCCT
CCCGCCCGACTGCCAGATGgatcaactgctgcgtcgctccACGGTCTCCATCCGACAAGTCACGTGCTCGTCCAAGTTTATCGCCATTGCGGACGAAGAG
CCCGTGGtgcgggtgctgctgcgcagcaaTACAGAGCAGGTGATCCTCGCAGAGGGGGCCACGGGGGCCATCAAGAGCGTGGTGCTGGATCCGCAGGAGA
AGTATCTCTGtgccagcagcgaggacgcgACAGTGCGAGTCTTTGCACTGGATGCGCCGGGTCAGCGTGCTACGGAGagcaagagcttcaagatcAAGCA
CGGGAATATCAGGCatgacgacgtgctgctgcggtgtGCCTGGCAGCCGGGGGATGCTGGCAAGTTGCTGGCCGTGCCGATGGACAAGGGCATCATTGAG
CTCTTCGAGAGAGACACGTGGGCGTCCAAGGGCAGGTTGATGCTGCCGATTGGCAGgagcactgctgctgatgtgGACATTCTGGCGTTCTCGCCGAATG
GACAGTACCTGGCAGCCGTCACGTGTGCGAAGGAGGTGTTTGTGtgggagctggagacgcagactGTCCTGCGCTCGTTCAAGATTGACTACCCAGCGCT
GGGTGTCCAATTTGCAAACAAGAGTAACGCACTGGTGGTCTACCACATCGGCGGTAAGTTGGCTTTTGTTAAGGATGTGGTTCCGGCGGGACGCACGCCA
CCCCAGCACATGTTCGGGCAGTCTGTTGCAGCTACTACAAGCACATCGGTCAAGTCCTCGCAGTCGGGGAAAAAGAACCTGAAGGCATCATCGtttgtgg
acgacgaggctgagGTGGACGGAAAGCacgatgatgaggacgaagaagaagttaGCTTCGATGACGACAACGAGGCACGAGTAGAGGCCATCAAGGCCAG
CTTCGGGTTTGGCTCGGCTGCAAAGGCCGCCAACGACGATCAtgttgaagacgaggatATCTCAGTCTCGGCTCGACCGACTACGAAGTCGTCGCACCAG
GAAGTTTCTCCTTTGCGCACCATCACAGAGCCCTTCCAGCCCGGCAGCATAATGGACCCTAccggacgcagcagcagtgccacCTCGTTGCTGGCATGGA
CTCCAGAGGGCGAAATTGAGATGATCCGTGGAGCCAGTATGAGCGAAAACCTAGTGAAGGTGGAGTTCACGGACAAGTCTCGTCGTGGATTCAAGTTCAA
CGACAACTACATGTTCTCGATGGCATTCCTGGACGACTACGGTGCCATTTTCGCCGTCCCGCGACGTGCTCGTGAAGACTGGGAAGACCTTGAAGCGGGT
ACCGACGAAAGCGACGTTATTAGCAGCTACATCTTCTACCGTCCGTTTGAGTCCTGGGCGAGCAACAGCTCGTGGCACAAGACGTTGCCCGATGGTGAGG
ATGCTGAATGCGTTGCCGCAGGTCGTGAGTTCTGTGCGGTGGCCACTTCGTTGCAAGCACTACAAATCTACACGGCGAGTGGCATCAACTATGCGCTGTT
GCGACTGCCTGGTCGCGTCGTGACCATGACCGCAAAAGAATCGTTGCTGGCCGTGGTGTACCAGGGACTGCACGGACAGATGCTCTACCAGCTCTTACGT
ATCCAGGTGGACTCGTCTTGCGAACGCGTCGTGCTGGTCTCAAAGGGCGAGTTGCCCATGACGCCGCCACCGCGGGATGTATTCGCACCGCACAAGGAGA
ACGAAACGATGCGTGAAGATGTATCGAACTGGTCGAAGCTTACATGGCTCGGTTTCGATGATCGCCAGATCCTTTACGCGGTGGACTCGTTCTCGTGCAT
TCAGGCGCTGTCGCCCAGCACAGGATGGAACTGGTTCCCTATCGGCTGTGTGGGTAACgcgttgcagaagaagcctGAGGACCGTCACGGAGTCTTTACA
CTTGGCGTTGTCAATGACTCGCTGCTCTATTTCCCGCTGGAGAAGGGCACTCGGGCTCCTAAGCTCCGCGGTAACCACCGCCCTGTGCCCGGTACGTTCC
CACTGCGCACGGCATCATTCCCGAAGACGTCAAAGAAGAACGAGGACGCCTCGAAAGGCCACATGTGGCAAAATGTGCGGCTGTGTGGTCTAGAGGCTAT
CGCGAACGAGGTGAACGCTGGTAATGTCGCGGACCAAGTAGTCCATGAGCAGGCCGAGATGGACAAGGCGCTCATcctgatgatgaagacggccTGCACG
AACGACGAGCCTGCGCGCGTGCTGGACTTGGCGAAGTGCCTGCACCTCGAGAAGTCCCACCAGATTGCACAGAAGCTCGCTATTCACTTCTctctgcgcc
agctccagtcCCAACTCTATGATCTGTACCGCGCCAAGTTCGAAGAGCCTCAACATTTAGAGCAGGAATCAATGAtgcgagcttcttctcagcCTCGTCG
ACAGCCTGCCGCGTACCGCCCTAGCCAAGAGGAGGACATGCCCGAGTCGCGAGAAGTGGAGCCTCTTCGTCGCGCTCGTAGTATTCTGTCTCGACCGCCG
TCCACGCCACCTCGTGAGgaacacgacgacgaggaaactGCCTCTGTCGACGAGACCCAAGAGACCAAGGGCCCACGCTCACCGAAGGCTGTTGCCACGA
AGGGCAGCGGCGCCCGCGTGGAACGATCAGTGGCACCGGCGAATCCGTTCCTGAAGAAGCCTGGCGGTTCCTCGGCGTCGCCCTCTGGCAGcaagggcgg
caagaagacTGGTCTGCAGCGGTTGGCCAACTTcgcgtcgccgccgccggccaagaagcagcgccgGTCGACATGGAAGAAGTGAAGTTACTGGAGCAGA
GCGAATGTAGGGGTCTCAGTCTCAACTACTACGTAATATAATATGGCGGCGCGTTTGTTCTTCGCAGTCTTGgggttgcagctggagatggagacgaatC
CTCCACAGCAAAATGTACGCTTCGCTACTGGGCTGCGCACCAAGATCGCCGCCATTTCCACCTGAGCGGGGTCTTTGATCTCACCCGTGCTCCACGTCTG
GGATAGACAGAGAGAGTCGAAAGCAGGGGTGCCTTTCCAGCTATTCGAGTTAAACTTCCGGTGGTCTAACGTGCTCGTACTGTACCTGTCTCTACGGCTT
TTACTGCGCTGAGTTGCAGTTTACCTGTACCTACGGCATAGTACTCGAAATGTACCCATCGCCGTGGGTTCAACATTCACCGAAGGTGGACGTTTTGGGC
AGTGAGCTACAGTTGTACCAGTACTcactactgtacatgcacatgtagcAGTCTTTGCATCGACCTTTGCTTAGCTCCGCCGTCGTCACTGGCGACGAAG
CTCCGACTTGAACCTCTCGCGGCACCGGGTGCAGTCTTCCACGTCATGGCCATGGAAGACCGATAGCAAATCAGCTGCTCCATGATCAATCGGTGCAACG
AGGTCATTCTGTGTAGCCATCACGGCGGTTGCTCGGGATTCAATACGGAGCTTACTGGTTCTGTACATACCACGTATCCAGGGTGGCTCGGCGGTAGTTA
GTGATCGAAGTTGCGTCATTCTTGTCTTGTTTGAAGGCGCTCGTTTTGAAGGCTTTGAAGGCTGCGGAACTCATCAATGCACGAGCTTGTTGCTTGTTGC
TTGGTGCCACGTGGCCTGAAGTTCAAGAGCGCAGTCGCTCATGACGTGTTAGGCCCAGAAAATCCGTTGCAACTAGGTGTTCGACAGGGTACCCGTGCTC
TCTGTGCAAAGCTCAACTCAAGTCACTGCAGCCATAGGGACGTCATGGACAATTCGCTGCGCACCATTCATCGTCACTCGAAAGAACGGCGCTACGATCC
TAGATCGATCATCAGATTGGTTCGAGATATGTGTGAAGCTATCGCAACCACCGCCATTTCGCGGCATCCCACATTTAAATCGGTGGGTACATGCACTCGC
GATGCAACGTCCTGCCGGATATCTCGCGTCGGCTGCTTCTGTGACTAGTTTCCAACCCACTCTGGCCTcatgatgacgacgacgatggtcGCTCGTCTTC
AAGCACGGGGCTGTGCGTCTTTTTGCTGGGCAGTCTCCGCCATTCCCAAATTGACCGGGAGTCCGCGACATCGCCTCTGCTAGGCTCTGCATGAATGCCC
CAACACACGCCCGCGCCTCCATCGTCGACTCCTGCAGCGCGCGTTCAGCGCCGAGCGATCCCTCGAGGACGGTCGTGGCACAACAATGGCGACGACAGAT
TGACCCGCAAACTCAtgatgctgcggctgcggcggctgcaTCCGACGCTAGCAGGGACCAAGTGCGCCGCCACaggcagcaacggcagcaccgtcgCGGT
GCCGTCGCTGGTGCAACGTCTGGAGTGGATGCTGTACAACGCAGCCCACTCGATGCATGAATATACACATGAACAGTCACTGGAACGCCGAGTGCAGGCC
CTCGTCACGCAGCTGGAGCCAAAGGTGGTCCCTGAACAGAGACAACAGCAAGGTAGCAGTAagcttattaatagcagCAAACGAGAGCGAGAAATGATCG
GCGGTGATGGAGGTGATCACAGCTCCGACAAGAAACGGCAGTGTCGGAGCGAACAGGCTTTgagtgacagcagcaggtctGTGTTTTTGCTGGAGAATGA
CGACAACCTCGTCGGACTCGTGCTCAGTTTTCTCTCTGGCCGGACGGTGCTTCGGTTGCGCTCGGTGAACCGGTTCATGTGGGAGAACGCGCCAAAGATG
ATGAGTACGCTGCACCTCGAGACGCACTCGCCAGCGCTACAGCACTTCTCGAGCGGTACACTGTCAACGTTGCTGCTCAGTTGCAACAAGCTTACCAGCC
TCGTGGTGACCAGCAAGCTTCGGGACTACGCAGAGTCCGACGAATCGGTCAGAAGAACCACTCGAGTGCTGAATCATCGGCGACCCCCTTTCATCCGTCC
ATCTAATCGAGACGACAGACTAAAGAACAGCTTGCTTGCGGGTGAGCTAGTGCTGAGAGACATCACACGTGCGTTTGAGCGAGGAGCGTGTCCTGAGCTA
CAGGAACTGGACCTCGGATCACCACTCGACTATTTCGCtgagagcgacgacgtgctgcggTGTCTGGAAGCCTTCACTACAGGGAGACGCCGTGGTGAAG
GAAGACAAAGGGCTGCTCGACCGCTCGCGTACCTGCGGCTCGACTCGACTTACCTGGGCGATGCGCGCCTGAACCGTCTGGCGGATGTATTCGAACAGGC
CAACTGCGCGAATAACTGCTTCAGTtcgttgaagacgctggtgctgcgaaACAACTTCATCGGCGAGGCCGGCTgccaggcgctgctgcgtatGATGCAG
TGTTTACCAGCGCTTCGGGTGCTGGATGTGAGCGGCAATATCCTCACTGATCTGGacgcgctcgcgctcgccgACTGGATTTCTTGCCGCGCGGATGACT
TCAAATCGGATCACCATCTTCGCACCCAAAGTGggtgctgctccagccaCGAAGTCAAgccgagctggaggagatcagACACGCCACCCGTCCAGCTGCg
cacactgctgctgcaggacaacTTTATCGGCCAGGAAGGGCTGGAGGCGCTATCCTCGGCACTCAACGCCCGGCTGATACCATCATAAACAGCGCCGCAC
AGTCATTGCCGCTTGTAAAGCTAAGGTCGGAGGAAGGAGGTACTGTAGCGACCGTCAAGGCTGgtgcgtacatgtaccggtaccggtaaACAGACTCTCA
ATGCGATGCACGATGCAAGTGCAGATCATTTATGAGTGATCGACAGTGGGACCTGGGGTGGCGATTGGCGAGAAAAACGCGCGATTGCGATCACTTGAAC
TTCCCCGTCATCGTCGATATTCAACACCGAAAAGTCGCGTCATCATTTTTGCCAACGTATTCATTTCGAAAGGAAAACAAAATGAGTATTTGTATTTGCC
GTATGATTCAGCTAGTATCAGATGACAGGGGCTTGAAAATCCAGCAAAACATTTTACGAAACATTCCCAATTCTTTTCGGAGCTCTTCAGTAGGTATCTT
CAACTGACTTCCTCGAGTCCATTGTTGCGGACGCTGAGGTCCACCCGATCTGCGGCACAGTCGGTCGAGCACTGTATCGCACGCACTTGTTGTATCGGGC
AGACCCCCGCGCTACCTCCTCGTCGCAGGATTTCTGAGTGCAAGGGCCTTGTCCCAAGGAGCATGCAGTGGAGTGCCTTGGGATTTGACAGGGAGACATC
GCGTTTCTCTGAATTCCAGCCTTCAAGCCCTGAATTCACGGCCGACCGGGCATAAAGCAGCAGTGGGTGAATACGCGACTACGCGTGCGCACGACGGTCG
GTATCTGTTACGCTCTCTGCTGGTTGCATCCACGCGTGTAGCTTACTTGGCTGTGTGCTTGGCTAGAATTGATTCGGATAACTCACTCGATCATGCGTTC
ATGTTGCTGGTTTTCTGCCATCAAAATGTTAAGAGGATACTTACACACTCTTTGGAAATATTCTGAAACTTCTGCGAGCGCCACTGGTTATTTGTTGTAA
AAAAAATTTAATCACTGAAAGTACGTTTGCTCGAAACGCCATGTGCTTGATAGGCTATCAGTCGTTCGCGAGCGAAAGTCACGCCAGAACGGACAATTTT
GCTCAAAGCCATGCCATCTGATACAGCCTCGCCCCGCACAAGTTGCGGAGCTACCGGGCAGCCGGCGCTCTATCCGATAGGCTTGTTGACTCACCAGCAG
GCACGCTTGCGCTTCACGTGCACCGTCGCATCATATGTACCTCTCTCTTCATGATACCTTTTATATTAAATGTTATAGACGTACTAACAGCATTAAATAT
AGCATTTTATTGATATCAAATGTATTCAACGGTATCCATAACCTCCGCAACTTGATATCGCTGTATCCTCGCAATCTCCAATATTTGTTCACGTCCTCTC
GAAAAAACGCTAATCGCGCACATCGTCTGGTTTCTATTTCCCGGGTCCGTATTTCAGGAACGATtcggcttcatcatcatcaacccctacatgtacctga
CCGGCGTTAACCAATTCCCAAACTCTCCTGACCATTCCACAACCTGCCGACTCCTGCCCAAGTCTCTACGCAAAAGTCGACTCAACTTGTCAACCgcagg
cgctgctcatggtCTCTACTACTGCCGCGTTCGCCACCAGCCCGGCGTGGCACGACCCGACCGACGAGCAGGTCCGCAAGCTCATGATGGCGCGACTGCG
GAGCCACCCGGCGTTGGCGCAGCACCACCCGATCCTGCAGGCACGAGAAGACACCGGCACCAGTCCGTCGCTCTTGCAGCGACTCGAGTGGATGCTGTAC
CACTCCGCGGGCTCCTTGAGCGAGTATCTGCACCAGCCATCGCTGGAGCGACGCGTGCAGGGCCTTGTGACGCACTACAAGCGCAAACGCTCCGAGACCG
ACCCGAGCGAGGACGTCCTGGCGTCCATCCGAGCGTCCGCCGCCAAACGACAGAGACCAACCCAGTTGACGATCACCGATGAGGAGATCcgcaactgcag
cgtcggGGCCAGAGGCTGCGTGCTCAACAGCAATTtggacctgctgcaccacgtGTGCAGCTTTCTAGACGGCAATGACGTGCTGCGATGTCGAGCCGTC
AACAAGTTCCTGTACCTGCATGCGCCGTCTTTCGTGCGGTCGCTGCATATCGACGCGGCGTCTGCTCCGGTCACGGAGACTCGGAACCACGGCGACGGGG
CTGCGAGTGGCTTGTGCACTCTGCTGCACGCATGCAAGAACCTCAGCAGCCTCACGATCTCGAACCAGACTAACCAGACACATCTCAAGGCGGGCGTCGT
CTTCCCAAGGGCActgacggcgtcgacgtaCATGGCTTCGCTCGCGACGGCGTCGTACGGCCTCCAGTTGGTTCGCGAAGTCGCCAACGCGTTGGAAGGA
GGAGCGTGTCCTTCGCTGGAGAAACTGGAGCTCCTTGCTCCGTTTGACTTTGCAACGGAGAGCGACGGAGTTTTGCTGGTGCTCCGAGCGCTGGCTGAGC
CCAAGACGGAGCAGAGGAATATCAGgaagccactgcagcacttggtgctTGATGCGACGTTCCTTGGTGATCGCGGcgttgagcagctcgccgagCTGTT
TGAGACGCGGGACACgttcttccagcacctgcagacgctgactGTGCGTAACAACTTCATGGGCGAAACAGGTTGCCGCGCTCTGCTTGAAGCTATTGAG
CCATTCGGTGAGCTGCAGACGTTGGACCTCAGCCGCAACATCCTGACCGACACGGACGCATTTGCGCTTGCAGATTTGCTCGACGATCCTGTGACAGACA
TGAGCTTTTGCGACAGCATGGACGGTGACCGGAAGGTTTCGTCTGAAGATGAGCAAGATGAGCGTGAGCTGTTGACCGTGCTGGGACTTGCAGGCCTGCG
CACCCTCAAGCTTCAGGAGAACTTCATCACGTGCGACGGATTCCACGCCATTACAATTGCACTGTGCTCCAGAGAAGGCTTCGTGACGACGGTCGGCGAT
GCCACAGGTTccaacgaagacgaagtggatgaagaagatgaagaagatgaagaagaagtagaaTTGATAGATCAAGAGCACTAGACGATATTTATGAGCA
AACACGCGAAGCAACATCAATACTACAGTATAAATAGAGTCGCGTTGGTAGTAGTGCACCACCACACTGGAGCTCCTGCCTTTGTGTCGCAATGAACTGT
GGGCACATGCACCACAGAGCATCTACGAGTTGAGATAGTCACCAAAATTGCAAAGTGAATTGGCCATGGCAGCTTCCAGtcaagacgacgacgaggacga
agaacgTCGTGCACTTGAACAAGAGCTGGCAGCAGAGTTGGCTGCGTTATCTGCTGAGGATGTCGAGCTTGAAGGAAGTTTGGACGGCCATGATGACCAG
AAAGACGACAGTGCCGGCTGTGTGGATAGAAATGGAGAAGTCGAGATGGACTACGTGCGCTTGGACCTTGACACGGTGTTGAAGCAGGTGGCCAAAGTCT
CCGCTGATGAATTGCTCAGCcactacagcagcagcagcagcagcaaagacgAAGAGTATCGAGTTGCACCTACGGCttgggagctgctgcttcaaagTGT
TGAACGCAGTGACCAGGAGTTCTTCCAGCCATATCATGAAAACTTGCACGACATTCGTACATCAATCCTAGATGTGGAGTCTTCAACTGCCCTAGGAGAA
CAACAAACGAATGGCAAAGTCGAGGAACAATTTTGCTTATCGGACGAGAAAGTAGATCAAGAAACTCTCGAATTTACGTCTTCCCAGCCTGAGCAGACTG
GATTGTCACCTCCTTTTGACGAAGGACGCGTAACTTTGTATGAGAAGGTTGACGAATGCAAACAGGAATGCGGCAACACCAAAGATGAGAAGGTTATTAC
AACCAATTCGTTTACCGACAACTCGTTGGAGCAGTCCATTGCCAGTGAACCTCCTTCTGTCGTCGAGATGGCTCCAATCGATCCTATATCACCACCTCCA
GAGGCATCTGACGTCTCTAACGTGCATCTTTCGGCCATTATcttcgaagaagaacaaccAGTGGATGACCAAGCTATGCAGAAAGAGCTTCAAGCCATAG
CAAAGCAACACAAAGCTCGAGAATTGCGGCGTTTGAAGGCCCAGACGAGATACGAGAAGGAACGCTATGATGCAGCACAACGACTGCTCCGTCTTCAAGA
GGAATTTGAGACTCAAGAGAAGCAGGCAGAGATTTCTCGTCGTGAGGCTCAAGAGCGATCTCTAATGGCCAACGAAGAAACGCGTTGTCGACtgtatgct
gctgctgagcgtgaAGCCTACGAAACTGCGCTGATGACTCTCGCTGACGAAGCTTCACGCAAGTTTGAGAGTGAATTGGCTCGGATACAAGACGCCACAA
GCAAAGAGGTCGCCCAAATGACAGACGAGGATCAAGCTGAACGGCATCGAATGCAAGTTGAGCGACAGGTTCAGTGCCAGAAGCAAAAGGCCTTGGCTCG
GTGTCGATTTGGCATCGTGTTGTTGGATCTGGTCGAGCACCACAAAGTTCAGCGACAGATTCGAGACCAGCAAACAAAGCGCGAGCGTCGTGAGTGTGTT
CAAAtgcgagctgaagaagccTACACGAGACGCGTAATTGGACAGTCCCGTGCTCTTCGCGAGCAACGGGAGCGTGAAACAAATCGTGAATTGATGATTC
ATGAGGATAAATTGTCAAATGCGCTTGAAGACTTGGAGAAGAGTGAACAACAGCAGACTcaggagcgactgcgcgaGGAAGACTGTCGAGAATGTATGGA
GAAAGAAGAGCAACGCACTCATTCTGCATGGACTTTCATTGAGAAGATTCAGCTTATTCAAAGGGAGAATGAAGAACACTGTCGTCTTACTATgaaccaa
gaagacgaacgtTGTAGATGTGTCTGGGCATATCTAGCAGAACAAGCCGAagcagaaggacaagaacGTGAAAGACAGCGTGAGATGCAGCGATTACGGA
TCCTCAGCAAAGTCTCGGCTGGTTTTCAAGGACTTGAACGAGGTTTTCGTCAACACAAGTTGATAAAATGCCTTACgaagtggaagtggtggcACGAGCA
GTGCAAGGAGGCAGAGCGTATACAATCTACAGCCGCAGATAATGCTGCAAAGCGGATCCAGATGTGGCATCGATCGTGTCGACAACAACTCGTTTCAGTG
GATCCTCCTCTCTTTCTCGAAGATTATagcgatgatgaagaagaaccgcaagttgaagaagatgatgtcgaagTATTAGATGCTGAGGTCTGCGTCAATT
CTCCCGTAAACCAAGAAGCGGCACTCCGCTTACAGTCGACATTTCGTGGTTTTCACGTGCGACGAAAGTTTGCAAACGCTCTAGCACTCGCGCAGGCagt
ggacgagcacgaggaagGCGATTATTTTGACGCTGTGGACTTGGACGACCTCATTCAGCTCCCACCCGAGTTGGTAGATGGCTGGGAGGACCCCGTGCTG
CCACCTACGTCAGTTCTTACACAAAGACGATATCCGCAACAGATCGATCGTGAAGAAAGGAGAGTTGACAACGTTGACAATaacgaggtggaggacatgg
aggacgaTAGAAGCATGAAAAGTGCCAAGCCTAAGGCCAAGCCGAGTGTACTAAGCGCACCGGCGACTGGAAATCCTCCTCCTAAGGAGCAGAACTTGGC
GGCGACACTGTGGAATAAGATGAAGCGTgtgaagcagcgccagcaacaTGCCCAACAAgagcgtcagcaccagcaagacCCTGTCTATCGagtgcagaag
ctgctgaatcGCAAGCCAAACGCTCGCCACAACTCGAGTCAAAATGGGaattcaagcagcagcagtcaggGCCAAGGAAGTCAGAAAGCACCCAATCTGG
TGTCGTGGTCTTCGACGAGCAgtacgaagaagaagccaaaggtgaagctgccgtcgctggtTGAGCGACTTCGAAAGCAAACGATGGCGGAGCGATGAAC
GCTGGAAACCATTCGCGGTTAATTATTGAGCGTGGTTTAAAGCCTGCATCCTTCAGCGCTTCGCCAGCAACGCGGCCTCCTTCGTTTGGCGCATCATGAG
TACGAACACATCGAAGTCTGCAGTAGCCACCAGAATCTCAGAGCAGAGCACAGTCCCCGACTGACGGTCGATCTCGTACGCTCGACGCACCAGCTCGTAA
AACTCTTGCACGGTTGCTCCCTGTGATCGGATGTACGCTACGAACGCTACCAGTCAGCTGCAATCAATTGAAGAGCACTGATGAGTTCGCTTACCTTCCA
GCTTTTCCTCAAAGAGGGCGAGGAACTCGTTGTAGATGTCCGTGTATCTGCAAAAGCACGTCGAGACGAGAGTTCAGTTTTGCTCGGTTCAATCTACAAA
CGCCGCTCTTCAACTCACTCGAGTTTcatctcgtcgctgtccaggTCGAAGGCGTGACAATGAAACTCCGCGAAGGTCTCGAACGTGTGGGCGAactcgt
cgttgtcgaagaagaaggagatgacCTTGTTCACCAGGTCGCTGCGCTCCGATTCCAcgttgctgccgtcgtcgtctttcGCGCTCGCCTTTTCGAGTCC
TGCATGAGCTTTGGATTCGCTTGGTGCACCCCCGACATTCTTGTCGCCAgccttctcgtccttgaaGTCCGCGTCCGTCTTGCTCTCGCTGGGCATTGCA
CTAAGCTCGTTCTCGTTTGAACTAAGCAACACTCAAGTAGGAGAGCTTTAGGGGTTTCGCCGCCGAGGACTCTTCGCTGCGTCACGTGAAACTTCTCGAC
ATTCTTCTAGCAGGTTGATGGTCGAGATGTAGGCGAACCAGGCAGGCTCACAAAGAGGTAAAACCTCGATCTACCGTAGTCGCCACTCAACAATTCGGGT
GGATGCAGTGATGTGAGCTAAAGATTCGTGTCATGCACGTACTTGTACTTGAACGGTGCTTGGCCAAGTCCGAGTTGAAGCGCTGTCAACAATAACAATT
GCTGTACCGGAGACTGCAGAGTTTCCCACGATGGTGAAGCCATTTATCCCACCATCCGAAGACGACCATTGCCCATGACTTACATGCCCTGCAGCATACC
TGCCACTCGTTGACATCTCCGAGTTGATTGCCTGACAtccaccagcgtcttgaggCGGGAGACTGCTCTCCAGCTAGGTAGAGCGCAAGATGGTAGTCTA
CCGACTCCATAACCATTTCGCATTTGGCCACCTCGAGCACCAACGTCCACTTCGATCCAGTCGCTTCCACTTGCCATGCTCCGACATCTCAAACTCGTAC
TTGCGTGCAttgccgctgtcgctgcacTAGTCGACGCTCACTTGGAGGACGTCCCCAGCTTCGCTGTCCCGTCATTCGACTATGGTTCGTTGCACGACGG
TGACGCACCGGACCGCCTGCTTCAGGCCTTGGAACGTGGAGGCATCGTCGCACTCAAGAACATCCCAAACTACGCCAACGTTCGGGAGCGCTTCCTGTCT
AGCGCAGTGCAGTGTGCGGTTGCTTCCGAGAATACCGACGAAGGAACGCGCTAcctgtcgacgaagcagttCCACGACGGGACTCGTCGACTCACGttgc
gagctgctgcaggtcgcGAGCTCCTGGATACGGACAGCGAGTCGCTGAATGCCATGGCCGCCAATTGCCCAGGTCACCGTGAGCTGTATGAGGAATTCAG
CAGTACGCTGGAGCGAGCGGTGGACACGTTTGCTTCAGCACTTGACACGACCGAGTTCACGATGGGCGACGGCGAACGACACATCAGTGCACGAAAACTG
ATTGGGGACGCTAAGCGTCTTGATCATTTCCACGCGTATGAAGCTGCTCCGGCCCCACCAAGCTCCAGTCGCCGGTCACTTTCGGCCGAGAAAATTGAAC
GGGActtgtccttggccatgCACGAAGACCACGGACTCTTCATCGCAATGGCAGCGCCCAAattcttctccatcaacgcTGAGGATGGAAGCATCCGCGA
GAGACGCCTGAAGTCCGATGCGTCGGGTCTAGTgatcggagctgctgagctcgaTGAAATTGTCCGTCCAGAGCTGAAGGCCGACGAACTCGTGATCATG
ATCGGCACCGGTGCGTCGCGTTGGCTGGAGACCAGCCACCACCTGCCGGCCGTCATGCACGGAATGCGAATGCCGGAAGAAATGGTCTGGGACGATGAAG
TAACTCCAGGACAACGCAATCTTCGCGCGTGGTTCGGCAAGATGACGTTGCTGCCTGCGTACCAACGTCTGCTCGAGTCGAAAATgtacttcgacgagtt
cacgAACCGAACAACTCGCCACTTGCTTGCCAACGGGAACTCGAAGGACGACCTCAAAGCTATCGGCTGCGCGGGTGGTCGTCATTTGGTGGAGAGTGAA
GGGAGCTGCACCTTCAAAATCTGCATCTTGAAACCAGGCGTGGAGAGGCCACCGACGGTGGGCTGCAAGCAAGCGTGCAACTACGGCACGGAGTTCTTCG
ACGCCAAGTGTGAGAAGAAGTGTGACTGCACCGGAACCACCACGCAAGCTGATGACTGCTGGATGCTTTGTGTCGCTCGGCTCCCCGTTAGTGAGTGCGC
GCTGGAAGACCAGGAATGCTCAGGCTTGAAGATGATTTGCACAGTaaacagcaccgacacgaaCGCAACCTCAGTCCCCGCGACATCAACGGAAGCGCCT
TCATCCACGGAGACGCCGCTGGCAACCACGGCATCCCCTGCAACACCAGAGCCCGCGACTTCATTGCCGACTGATCCCCCAATCCTCACAGTAACACCAC
AGCCAGTTGAGACGAAAGCTCCTGCAACAACCATGCCGGCGATCGTGGAGCTAGCTGCAACGCAGACGTCACTTCCGACAGCTACGCCACCATCAACCAC
CACACCGACGACTGAAACATCGCCGCCAAGCGCCACGGAGACCCCGCTGCCAGCAACCACAGAGCCCCCGTCACCGACCGAGATGCCAACAACCACAGAT
CCGTTCACTGATGAACCTGTGGCGCCTGGTGGACACTGCTAGCTTTGCAGGCCACGGAGTCCAGATGCAAAACCTTGTTCATGCTTAGAAAGAGACGTTC
CATGCTAGTAACCTGTAGCAAGCAGTACACATCAAGAAAATACACCACCAACAAGCGCCGAGACGAAACAAACTCGACGCCTACAGCTCAAATAGCTCGC
TTTCATTCGTGAGTCCTTACCGGCAACTTGTGTGCAATCCTACGCCTTGCCGACCGCTTGGCTTTCATTCTTCTTTTCGCTGGTCCCATGACTGTCTGTA
ACGCGGCTTCCGTTTGGAGCCGCTGTGTGTTTTATCAGTGACTGCAACGCCCTCAAAGCGACGTTTTACAGTCAGCGCAGCTTTACTGTCGGCACGGGTG
AGTGAGTCTACATCTGCTCGTCCTGCGGTTCGCCCGCCACCTGTTCGTCCTccgctccttcttcctctgtGGCGTACAGCACCTTGAAAACCGCCTGAGC
CAGGGGGTTCGTCTCACTCTCTTCTGCCGACTGCAGCATAATCTCAACCTCAcgcagcttgttgaagtaGAAGTCACGTTCCTTCTCCAAGCTTTCCACC
TGTCCACATCAAGAAAGACACCACTTCAATCAGCTCTTCCACCCCTTTAACTAGTCTCCTTTTCATCCACTCACCATCGCCCGCAGCTCGCCGCTCTCGT
TCGTCAACGCCTCGTTGTTGGCTgtgagctcctccagctccttctccagtggcgccgtcgctgcagcaaccgcagcttcCGTGTCCGCCGCCGAgccagc
agaagaagatcctgCGCTGCCGATAGGCCGACGCGTCGTTCCTGTCGACGTCTTGGCGGTGCGCGTGGCTCCCGCACTCGTTGGAGCTCCAGGCGGCGTC
CTGCCGActcgcgacgtcgtcgtggtcgttgCAGCTCCTACTTTCCGACGcatcggagctgctggcgcagatgacgaagctgctcccCCACCGAACTTCT
GCGTGAACTGAGCGCCTCCCTTGCCCTTCTCGCGCTGCGCCACGGGGTCGTAGGGCTGACCGGAGGCATTGCGCTCGTAGAAGGCCTTGAACCACTGCAT
GAACTCGAGGTTGTCCTGGTACTTGCCGCGCACGAGGCGGTCCACCTCCACGTGCTTGtcgatcttgagctgcatgaaggccttctgcagcaccttgtag
TTCTGGATATACTCGTAGTCCTTGTTGGCCGCCCAGTCCACCTTGCTCATCTGCACCTTGCCAGGATACATGGCGTCCAGGATCTGGCAGGCCACGGCGC
CCGTGCACGTCTGCTCCACCTTGGACAGCGTCACGGCGCACAGGTTGTTGATCCAGTCCAGGATCTCCTTACGACCTACGAAGTACGTGCCGTCCATGAG
GCTCATACTCtggtctgcagcagccatggtggaggagttctgctgctgtcctgcTTGGTGGCGAATGCTGAAGTGGCAGGCCGTCACTTGGATCACTCCA
AAAAGCACACGCAGAGATTCGCTTAAGTTTATTTCTATATCGCTTAAGTTGTGACTATAGAAAAGCAGACCTTTAGAAACGGGCTTTGAGTTTAGAAATA
CGGACTGTATTCCGAAAgccatggccaagaagagcggAGGTGcgtcgccgtgctgctcggcTGCAACGGGTCGTCGTATAGCGTTGCATTGCGTCGTACT
AAAGTCTTAttcgtgttgctgtgttGCTATTGACGCAGGTTCGAAGGCCAAGGGCAATGCCGGCAAGAAGGCCGGAGGCAACAAGCCCAAGAAGGCTGGC
ATGTTcaaggcgctcaagaagcaagAGAAGAGGTCCGTGCAACGCAATGCAATGCACAGGCTCTAGGCTAATTCATCGGCTTATATCTGACTGTGATGTT
TTGCTGTTATTTTTGTGCCTGAGCAGAGCTGGCGTAGTTGGGGCGGACAAGAACGACCCTcaaagcagcaagaggaaggcgaagctggcgaagcGCCCAG
CGCCTGTTTCAGACGAGTTCCGCAACTTTGACGAACGTATGGCTGCCAAGTCCTCACGTCGGCCAGGCATAGTGCccaaggctgctgctgtggcaaCTCC
GACGTTCGTGATGGCAGCTCCGACCTTCCAGTTGTACGTACGCGGATGTCGTCATCGTGTTCGACTTTCCCTCGATTGCTGTGCTTGTCGAATGGTATCC
TTAACAAGATTCTGCTGCTTTTGATTGTTCCCACAGCAATGCCAACCCTGTGCAGTCAACGCCTGCTTCGCGAGAAGTGGAAGGCTTTCATGGCTTCATT
TCTGCGCTGGACGCCCCGAAGGATGCGCCAACAGTGAACCCGAACCAGGTAGCCCACCAATCGAAACTCGTGCAGCCCGAATACCACGGAAGCAACGTGT
TTGCattgctggacgacgacgacgaagagcagcagaagacgcagacgacCCCGCAGGCAGCGCCAGCGTTCATGCAGCCGGCGACGTTCATGTTCGCGAC
CAGCAAGCCGACCTTCACGCTGCAGTCTTCACTTCCCCAGAGTATGCAGCCGATAGCAGTCaatgcagcgcaagcagaagacatCGACCCCGATTTATAG
GACTGCAAACATGCATGTAACACGTACGAAGCTCTCTAATTGAAGACTTGTCAAAACCTCTGCAGATAGATAAACCTCTGCAAATATATATACATGTGAT
GTGAAGGTCACACGAACAGCGTGTGTCGCGACGGTCATAAGAAAGGTTGCATGACGGTCGCTGGAAACAGCATGTTACGTGAAGGTCGCAGGAACGCGGA
CGGCGGTTTATGTGATGCGTCGCCGTCGGGCTTCACGCTAGTTGTGTCTCTTTGAGAGAGAAGCCAGGAAGCTCAGCCGCCGGAAGAGAAGCGCAGCCGC
TTAGCAGCCCAAGCAGTTCAAGCCGAGCCAAGCACAGTCTCCGTTGCTACTCAGGCCATCAAGCGCGCTACAAACTACAACTGGAAGCGCCGTCTCTCGA
GCGGGGGGggtgagagagagagcacgcaacacaaacaacaccagcagcttcaggcACAAtgggcagcgccagcagcaaagcgGGCGACGCCAATCCCAAA
AACCTGGGCGCAGACCCGAACGACCCTAACGCATtcccgctgcagcaccatccGTACTACAACCAGGTGGGCCACGgacagacgcagcagcaacaacagg
gACGCAGCTTCGATGGCACAGGCGAtggcaaacagcagcagcaacagtacTATGCGGACCAAAACACCACGGAGGCCATGGACGTGGATCCGCCCACCGA
CTCCTCCTCGGGGGTGTCGTATATGGACGGAGATATGCCCTTCCCAGCGCAGCTGGTCGTGAAAGACGCAGAACACGGCAAAGGGAACAACGCACAGGCC
TCGGACGTAACGGTGCCGCCTGGGGAAGACGTCGTACCTATGGTGTTCAAGTGGGAGCACGGAGGACGCAACGTGTTCATCACGGGCACGTTTAACGGTT
GGGACAAGCAGTGCCCCATGCACAGATCCGGTAACGACTTCACGTACATTGCCAACCTCACGCGGGGGAAGCACATGTACAAGTTtgtggtggacgacga
ctgGCGGTTCGCGCCTGACCAACTCACGATGGCAGATGTGGAAGGCAATGTTAATAACTACGTGGACGTGTCCGAATTCGCGCCGCTGTCCGACTTTGAC
GGCAAGAACAagccgctggacgacgacgaagatccCGAGAACCCGTACTCGCGGTACATCCCCGAGATCGACGAGTACACGAAGGAACCACCTCCGCTCC
CGCCGCACTTGCGGCACATTATTTTGAACAAGGTAAGTCACTCCACCCGTTGCAACGTGTGGTGCAGCCAAAGATTTTGTGCTGTGCTGGTCCTGACTCG
CGTGTTTTTGCGTCTGTGTCGTGTCATGGTCGTTCAGGCGCCGCCAACAGTCGATGGGCGATTGCTGCCTGTGCCGCAGCACGTGGCGCTCAACCATCTA
TACTGCACAGCAATCAAGGACGGCATGATGGTGCTCGGCATCACCAACCGCTACAAGCAGAAGTTCGTGACCACCGTTTATTATAGCCTCATGCCCGGCG
CCAACTAGCTCTTGCCGTTTTTGCAAGAACTGGTTCGGGGGGTCGGTGGCGGGTCGATCTTCTGGATCGATTCAACGTAGAAGGCAGCACAAAGTAGTAG
AAAACGGGAGGAAGTTCGGAGCCAAGTCGTGAATGATCCAAGTGTTGGACGCGGCGTGGGCATGCAGTGCGCATGCCTGGCTCCGCTTCTGTAGGAAGTA
GACAGCAACTCTTTTTTTTGGtaaggagctgctcgcaaTGGTCGTAGCGAGCAGCGCAAAGTGGTAGGGCATGGCCAACCTAGGAACGGCGAAGCCTAAA
AGCAATGAGAAGCGAACACACTGCACCTTCGTCCTCCCcagccatcgccaccatcCACCCTCACGACGCATTGAAAACACGGCGGCAACGACCAGCACAA
AAACAATAAACATATttttgtcttcttctgcagcagcgctcgctcTCGCCAAGTCGTCCAGCGTGCCGTCCGACCAAGTTTCGACTTCAATTGACGACTG
TACTGCATTTCTCCGTGTCGTGCTGTTCTCCCCTCTCTTGTCCGTCAAAACTGCATGCTTCTCCTCTGCTTCACGCCGCCACTTTCCGTCTTCTATAGCT
GGAACAAGCTTCAGTCTGAGCACTTGGACCTAATAGCTGCAGgcagagctgctgggctGTCTGTCTATATGTTTATACGTAGATCTCGGCCCacaggaag
aggaagagcgagccgaaacccagcagcagagccgcGATGaaggccagcaccagctccaccagcgcgttcttcttgggggCCACGGCgcgcgtgaagaaga
gcgccATGAACACCAGccccgtcagcagcagcgcgaccgTGAGGGAGCCGTAGTTCTCCGGGTCCACAGGGCTCGTGTACGGGATTTCCTGCAGTataga
gagagagagggaggAAGGAGAGGGTCAGTAGCTGGAGATCAGTATGCGTATAGCGGTAGAGCACACGCAGGCCACGCACCATTTCCATCGTGGTGGCGAA
GTATCGAGAACTGCTTGGAGCTCTTGCTTGACTGACACGTATGGAATTGTTTCAAGCTCGTATGATATTTGAAAGGGTATGGATGCGATATGAGAGGTTT
ACGAGAtatgttgcagcagttgttgaagctgttgttgtgCATCATGACTGCGACCTTGATCGCAACAAAGTCTGGTATTGTCGTGTTTACCCAGCATAAA
TACGAAACTTACTTGGATTCGTCTCCTTCATGCATCGCCTGCTTGAGCCGCTGCACGAGTTTAGCTTTGAGACCCTTGGTGTCGAGTCCtcgcttcttga
gctcagCTCGCAGCTCGGCCACCTTCATCTTACCGACATTAGCGACTCGGTCTTCCTTGGGCTCAACGGGCGTTCCTGACTTATCGTCAtcagctgcaac
agcgacgtcggACTGAGTTGCAGGCTCTGCTTCCTCGCTTTCCTTCTTGATACTAGTCTTGGCTAGCTGGTCATTTTGCTTCGGTGCTTCCTTTATCTGC
TCTATCTTGTTCCCTTCCTCTTTTACTCGACTGGGAGATGAAGCCTCCGCATCGCTGTGGCCCACGTCCGTACTGTTCGCAGTTTCCCGAGGCGGAGTAC
CTTGTTCTTTTTTATCGCCGCTCTTTGATTCCGATTTGAACGGAGCCTTGCTGTCGTTCTCTCCGTCATTACTCCTTGTTTctgcggcgctgctgttaTC
CGCTTCACTACCAGACACGCTTTCCTGGACGATATCCTCATCTTCGATTTCCATAGCTGATGCTTTTGGAGACCCATCGGAGGCCTTCCTATCATCGTCT
GCATGTTCCTGCCCatgcttctcgtcctcctgaGGCTCTTTGCGGACTTGGTCCATGTCCTGGTCTCCATCTTCCATTGCTCCATCCTCTTTCTCACTCG
GTGCTTGCTCACCAGCGGCCTCCTCTTTCTCATCCTTCTTTACAGCTTCCAGttcttcacgaagctgctctaACTTGGTTGCAAACTCGGCTTCCAGCTT
TCGCAATTTTTCCTCGTGACTCCGTTCACTAGCCTTCATCTTTGCTTCGTGAGCCTCCATGGACGCAGCGACTAGCTCCTTGGTCTCTGTCGTGTGCCTC
GAGGGGAGATAGTAGATAGGCGGAGACGCAATAGTGACCAGAAACTTGGATTGGTTTTCGCTCTTCCTGACCATCTGCAAatgctccagcttggcaCGTG
CAACCTGCTCACTCCGGTCAAGTTCAGTGCGCGCCACCAACGCCTCGAGTCGCGCTACCTCGGCCTCCTGACGTGCTTGATTTTCGAGAGTCTGACTCTG
CATCTTCTCCCTCTGCTCCGCCTCCTGCTGTTTCGTGTCCTGGCGCTTAAACAAGTCCGTATCCTTCTCAATTTGTCGTTTCGCTTTGCCCAGGTGGCCC
ATCAGCGCACCAAACATGCGTCGACTGCGTGCAATACCATCCTTCTGTGCGTACGGCGCCACTGCACGTTGCTTCCTCTCCTGTGCACGAGCGCTGTTAG
CAGAGGGCGACGTAGCTGTGGTGGACGTCCTGCTAGTCTCCACTCTCCCCTCATCCGGCCTGGCCACTGCTGAGTGTAGTTTCTGTCTCTTCACTACGTT
GCTCTGTCGAGCGTCCTCGTTGTCGCGTTTCCCCAGCCTCCACGAAGCGTTGCCCCGAGCGTtgttctccttcagctggaCAGCCTGTCGGCCTGCGCCT
CCTGTGCGTGTCGACTCCCCACCAAGCCGCGCAAACACACTGCGTCGGCCTGCTGCTCCCccggctgctgctccactgCCTCGACGCTCTGCTAACAGAA
TAACAACGCAGAAGAGCAATCAGCGTAAGGATCGCAAGGCAACGAGTAGCTTTAGAGAGCAGCTACGCAGCTCGGGGGCGTATAACGACCAAACCAACAG
GCAGGGAAAGAGATCGAGGCCTACTTGAGTTATCGAGAgcctcgcgcttcttggtcAGCGTCTGTAGCTCGCGGCGCAGCGCGCGCTCGTCTGCCGATTT
TGCCCGATCTGCCATCACTCGGCGCTTTAGTGGTCGCCCTTGATTTGGAGGGGGCTGCTCAGCAATAATTGGTAGTCAATAAGTTTTGTAACCAATTAGA
GGTCTAAAAATATTTTTGACTGAAATAATTATTATTGCTGATATACAATTGTCTACTACTAATTGTGGTAGTCAAAAatcgtgctgctcgaagcgACGCG
GGCGCAGTTTGAAGTTGGAGCATGGCATCACCTCGTGCTGCTACTGACGACGCAGTGGCCAAGGCGTTGGAGCGACTACGACTCAGGAAATCTGGGATTT
TAGCTGGTGACCATGGTGACATACCAGCAACGGTAACACCTATGCCGACATCGATGCCAGTTGCGCAGCCTGCCGCTGGGTTCCAGGTCATCTGCTCGGG
TCAAGTGGAGAGCGTTCATGTGCGTTCGCCTTCCTCGTGTAGTGGCAGTAGTGGCAGTGAGGTTACTGCGTAAGGTCCACTCAGGGGCATGCAACTAACC
GCTAACTCTATGCGGCCACTAGTACCCGGGGGTTAGCAACGTATACTGCCGCTACGCTATTAGCTACGGCGTTGACTGGCGCGTGCTTCATGTAGGTCTG
CATTGCAGGCTCCGTAGCCATCCTTTGCTGACATCTTTGACAGATGCACTTACCGCAACGTTTTGCATTACAGGGAGCTGAGAATGGACTCTCGCAGATT
GCGTATCTGGccagcgatgaagacgagaTCCTGCTCAACTTTCCTATCGACGTGTCGTTCAAGAGCACGAACCCATTCGGCTGGCCACGACTGGTACTTA
GTTTGTACGGACTGGACGCGATGGGCCGCGACGTAGTGCGAGGCTACGGTTCCGTGGCATTTCCAGTGACGCCAGGTTGCTCGGTGCGCGAAATGCCGCT
GTTTCGAccaatgtcgtcgtcgcggaTACAGCAATTTGTGGCCTGGCTAACAGGCTCGCCGCCCGAATACTTCGACTCCAAGTTCGTGGCGCAAAGCGAC
AGCCGTGAGGTTACGCGAGTTACATCTGCAGGCAAGGTGCGCGTTGTGCTCAACGTCGCGACTCATGGAATGAAGCAGCACGGATACACGTAGTGAGAGA
AGCAAGTCTTGTCATTTTTCAGTGGTTAATGATGCAAGTTGCCATACAAATCAAGATGCACAAAGCCATGTCAAAGCCTAACACAATAGTGCGGACCCAG
CCTCAGCgagtatacatgtacctccAGCAACCTCAAGTCTAGCAAAAGGTGCTGCTTTGAGGACACCCACCGCAGCCTCCTTAGCACAATCCTTCACGCG
CCATCTCCGACATGCGCTCCGACAAGCGCTCCTTGATTATCTTTCGGCGCTTGCGGAATGATGTGCGCTACGTAGTAGACAACAATTTCGCAtaagaaaa
aaaaagttAGCCAGCCAGCCATAACACAACAGGTCGATAAACGAAACTTCAGCGCTTACCAGGCGGCCTTCCTTGCTAAAAAGCTCTAGGAAGCTGTGCT
GCATGTCGTCGGCTTTGCTGATCCACTTGTGCACGAATCCGTCAACATCGTTGCGAACCTTGTCTACTGCCATATCAAACTTGATactcttctccttgat
gaATGGCACATTCATGTCCTTGCCCGAGTAGCCGCGCTGCAAGTTCCGACGGATGAACGTGTCGTACTCCGCAATGATACGAATGATCAGATCCGACGTC
GAGATACCATCAGTGCGTCGCGTCTCCAGGAACTTGCCCATTGCCTTAATACGAGCATACACATCGCCTTCCGATGCCTCACCCGAAGCATCTGAGTACG
GCAGCGCATCGTGGCACACGTAGTCGATCTTGTGCTTGTCCAGGAAGTCGTCCGGGAGCACCCAGGGAGCGTCCtcgaccacctcgtccaccCACTTGCA
GTGACGGAGCGACTCATAGCGCTCCTTGTCCGTCATGACAGTGCGGCCCTTGAGCTTGTGCGTGatttcgtcgctgcagcagcccaCGATCAGGTAGGTG
TTGGGATAGGCCTCCTtgcactgctgcagggcTTTGGCGTGTCCGAAGTGGAAGAGATCGAAGATCCCATCAGCGTAAAGACGCAGGGGGCGTCCAGTTA
AAGTGCCGGGCTCTCCTTCtgtcagcttcttgcggtAGGGCTCCGGCTGcggttcgtcgtcatcctcctggctgctggcgctgctgttgtcgttggACTC
CTTCGAGTCCTCAGCCGCAGGCTTCGTctcggcttcggcttcggcggCAGGCGCGTGGTGGTCGGCCTCGGCCTCCTCTGCGTTGTTCATCTCGGCGGCA
CGTCTCTACATAAATCACGAAAGTCTCATCAATACTGCAGCCATTTGAGTTTAAAACCGGCGGATCCCGGCGTGTTTCGGCGAAGATCTTAGGCGCGATC
GAAGCAGAACATCGACGGCATGAAGTCCGACGCAGCACGGAGGCGAGGGGACACGCACCTTTCTCGCCATCTTTCGCTTCTGTTCGGTCGAACACTGCAG
TGACACGCGGTTAATATGAATCGAGTGTCCTCGTACTTAGTACGAGAACATTATCTTAAGTCCGAACGAACCTACCGCAAATGTGACGCGTCATCAtcag
ccacttcaacatcacgATATGCTTTTAATCGGGAATATGATTAGAGACAAGAAAAATGTCATAAAATTTATGGATTTAGATGACGGAACGATACGATGAA
GAGGAGTTGTATTCTCGTTAATAGGTTTGGATCACTCCAGCGCGTCACGACGATCAAGACGATGACGCCGCCGATAGCGATGCCACGCGAGTGCTGCCTG
AGTAGAGCTTGTGCGGCACGTTGGCGAGCTGGTTGCGCTCCGTGGCCACCGCAGGCTGCACGACGATCGGTACGTGCCACTGGAACGTTTGTCGCTGCGG
GACGGCGCCATTGCTAGAACCTTTTTGCGGCACCGGCGGTGCACCAGCCGAAAactcgaagcgcagcagccactGGAAGCGCACCAGGTCCGTTTTGATG
GTCGGTAGCGCATCGTGCGGGATGCTGAAGCGCGcgttcgtctgcagcacgccCAGCGTGCGCTCGCGGAAGCTGCCGAATACTTTGGACTGCACGACGC
GATCCGGATCCAGCGCCATTGACGAGAGCGTCTCCTCGAGACAGAGCGTAGCCGACACCTCGTAGCACGGGATGCTGGCGCGAgtgaagtcgaagacgcC
CAGCAAAACCTCTCCCGGCTGGTAAAACTGCTTCGTAAGCAGGAAGCGCACGAGGTGGCTACTGTCCTTGCCGATCGTGAAGATGCTCGTTTGCGcgcgc
tgcatctgctctgTTTCCACGCGGCCATGCATGAGTGAAGGACGCAACTCGAACGCGATCTCGCTGCCCTTGCGCACTCCAACGGGTGCTGGCGCCAAGG
AGACGAGTCGCCCCACGCGAGTAGTTCCACCCacaacctgctgcttcttgggcgTGGTCTCGGCACTCTTGTCGGCAGACATatcgctgccgtcgtcctT
GCGCTGACTCGCCGCGATGTGGCTAGCACTAGCCACTGTGCCGGCCTCGAAAAAATACTCGGAGCCATAGACATCAAACGGCAAGTGTACCGTGACAGGT
TTACTCCCAGCAATCGCACATTGCGCTGTAATAGAGACCACGTAGAAGACCCTAGCGGAGGAGCCGCGGAAGGTCGGGCAGATGTTCTCCGGTAGTGCAA
TGGCGAATTCTCGCGTGCAGCgctccgccgtctcctcTCGTGCAGCCTCGGCTGAAGACACAGGGTCAATAGCTCCTTGGCTCTTTAGAGTGGCGgactc
cagctccgactgTGTTGGCGCAATGTTGATGTCCGAAAGCAGAACCGACGGCGCCGAGCGGAAGATGCATGTGCCTGTGTCCCCCGAAAAGTTGCGCACG
TCAGGCAGCGCCGCACCCATCTTGTCGAACAGCACGACGTCCTCTGATAGTTTGTGTTCCAGTTGCGCGCGCTCCTCTTGTGATGCTGCCCGAGGCGATT
GCACGTGCACCACTGGTAGCGTCAGCAGGTTGCTGTCAACCGTGACGTGACCGTGGACTTGAGCCACCACGTGGGCAATCTCCGAGTGTGCGTCGGGATT
CCGCTGATGACTCACAAGTCTCACCACACCCTTGACGACACCTCCGGGCCGGAAGTGGCGGCTCGCGAGCCGAGCCACCAGCACGCTGCCCTCGGCCGAC
TCCGTGACGTGGTCGATCGTCATGCTGCAATTGGAATTGAGGGAAATCGAGCGAGATTAAGTGCGATAAGCGCACTTAGGAGTGATTGTTGTTGTGTACC
GCACACcaacgttgaagtgagcTCGTCTTCGAAGACCGTCGTCTTCGAGTTGAAAGCATCGCATCCGTCCTCTCCCACCAACGGCAATGAGAAACTGAAC
GAGAAGGCTGACAAGTCGACCCCCCCCCACTATACGTGGTGTCTGTCGACGGTGGTGCCATCGGCGAGCAGTCACTCCAGCTTTCTCTCGACACTTAACA
AGTCCAAGAATCACTCGAAGATGGCTCCGGTAAGATAATGTTGActtttacatgtactacgtagtatgCGTTTGTGTCAAGGAATTTCGCTAAACTGTTA
CCACGTTGGACATGGCAGACTGCGGCCAACACGAACGACGAACCCAAGCAGGAACTTGAGCTTGACCGACCAGCGAATGCAGTGGCAGCTAGTGAAACTA
GCACCGAGTCGACAAGCTCTGCGCCGTTCCGCAAGATGCTGGCGGAAGGTGAACCCGGCACTTTAACCGGACGCCCCCTGCGTCTTTATGCTGATGGGAT
CTTCGATCTCTTCCACTTCGGACACGCCAAAgccctgcagcagtgcaAGGAGGCCTATCCCAACACCTACCTGATCGtgggctgctgcagcgacgaaatC
ACGCACAAGCTCAAGGGCCGCACTGTCATGACGGACAAGGAGCGCTATGAGTCGCTCCGTCACTGCAAGTGggtggacgaggtggtcgaGGACGCTCCCT
GGGTGCTCCCGGACGACTTCCTGGACAAGCACAAGATCGACTACGTGTGCCACGATGCGCTGCCGTACTCAGATGCTTCGGGTGAGGCATCGGAAGGCGA
TGTGTATGCTCGTATTAAGGCAATGGGCAAGTTCCTGGAGACGCGACGCACTGATGGTATCTCGACGTCGGATCTGATCATTCGTATCATTGCGGAGTAC
GACACGTTCATTCGTCGGAACTTGCAGCGCGGCTACACGGGGAAAGAGATGAATGTGCCGTTCATGAAAGAGAAGACCATCAAGTTCGACATGGCGATGG
ACAAGATGAGGCTGCGTTTTACGAACCTCTTTGGGCGGAAATCTCGTCGCTACCAGCAACGGCAATCTGTGtaagtgctgctggcatcaACAATGTTCAC
CCCAGTTCGTATAAAGAATTCAACCTTGAAGCTCTTTGCCATTTACACACGTATCGCATCAACGAGGAGCAGTCGCAACTCCATGAACAGCTCGCTGAAC
TTTTTGAGCAGATTTCGCTGCCACCAGCAAAGCTTGTAATCCTGCAAGAAATGCACGACAAGTCCACAAGTCAATATGCGGTGAGTAGCTCATACTAATA
AGCACCTCACCTCACGGCAAGGAGCAGAGCCAAACAACAGCGTACCACTTGAGAACTGTTTCTGTGCCTGACGTAGGTCACTCGGCGGCAACGAGCTGAA
CCAAAGGAGCGTGTCCAAGTTCGATCCTGTTTTACTGCTCACTGCATTGACAGGatcttcgtgctggttgcTCGTTCCTGCTCTCCGATGATGCAGCGAC
GCGCCTCCGCACTTCTTGTCAACCTTCTGCAACTTTGCCTCCGTCGCATCTTGCAGCCGCCAGTTCCCTTCCGAATCCAACGTCACCACGCGGGACGCCT
CTAACTCCTCGTGATACGAGATTTCACTCAGCGCGTGCTCCGGTAGCCGCAGTTTGGCCTTCGTCTGCATCAAAAATCCCTGCGCAAAACGACGTTAACA
TGTCTCGAAACCAGCACCTTTGTCGCGGTAAGTCGCACCTTCTTGAGATTGGTGCACGCGACCTCATGATCGTCGAGATACTCCTCAAGAGACTCGATGC
cctcgaccagcagcttgtcaaCGTCCGCGTCCGCCTTCATATTCCGATCTTGTGCAAATGAGAATTTTGTCGTGCCAACTAGAAAATTGTCAGTTACTTG
AAGTAAACTTTTGCAGTAGACTTCCATTCTGGCATGAAGATGTCCGCACAGCGCAGGCAGATCTCGCAGGAGACGTTCGACGAGTGCGTGGCCGAGAATG
TGGAGGACTTCGACATGTCGCTAGAGGAGGCGGTGGCCGATGCCGCGCAGCAGTTCGAGTCGCAGGGCGTGGATCTGTCCAACATCATCAAGAGCGGCGC
GGCGCAGGCGTCCGAGGGTCAGGAGCCGCTGCCTGCGCGGCTGAAGCGGCTGATCTCGGAGTTGCAGGAGCTTTCGAAACTCAAGAGCGTGCAGGAGCAA
GTGTTGAGCCTCGTTGCCGAGTTGCAGAACGTCTGCGAGGAGGTGCCGGAGGCTCGCGTGGTGGCGGGACGGAacgacgtcgtggacacGCTGCTCGCTT
TGCTGGACGCAGATTCCGCCGCTGTGGTGgcgtcttgcagcgctttgttggtgttgctgtgtgCAGACAATGTGGACAACCAGGACTTTGTGGATGTTGC
AGGGATGCAACGACTTGTGGAAGTTCTGAAGCTTCAGCGGGAGGATACGGAGACCGTCGTGCGGGTTCTAGCGCTGGTGAAGGCGGCTTGCGTCAAGCAC
GAGAGCAACAAAACGCACTTCATCAAGTCGGATGGTGTTGTGGCGCTGTGTGAGCAATTGGACAGAGCGAAGGACAATGAAGCGCTGTCGAGGCAACTGG
CGCTTTGCTTCCGTGTGCTAACTATCAACGACGATCCGCGCGCGACGTTTTCGCAGGCGCAAGATACCATCAAGGCCCTCGTCGAACGTGACGTGATCCC
GTATAGTTTAGAGATCCTGCGTCGAGTTGGACgcagcgatgcagcagcacaggtATTAAACACCTCGCCGGATCTGCTAGTCAACTGGCTTGCAGTACTC
AAACAACTTGCCGTGACGGAGGAAAACTGCCAACAGATCGCCGATCTGGGAGGTTTGACCACCGTCCAGGAAATCATGCAGGCGTATGAGCACAGCGCAC
CAGTTGCCAAACGTTGCATTACAGTTTTCCGGAatgtggcggcggcggacgATCTGAAGCGTGCAATTCTACAGTCTGGAGGCATCGAGCGGACTTTGCT
GATCATGAAACGCCACGAGCCCGATGCGTCTATCCAACAAAACGCGTGTGCTACGCTAGCTGCGATTGCACTCCGCTCTCCAGAGAACAGCCGTGCGCTA
GTCGAGCTCGGAGCTATTCGGCAAATCTCTCGAGCCATGCACGTTCACCACCGTGACGTATCTGTATTGCGCCAGGCCAGTCTGGCAGTGCGTAACATGG
TGGCTCGTAGTGTGGAGCTGCGTTCACGCTTCTTACACGATGAGCCAGAGATCGAGCCATTGCTTCGCGAGGCGCAGCAGTTTCGCGGCTGCGGCGACGA
AGCCTATGCAGCTCTACGCGACCTGGGTTGCGATATTCAGTTGTCTTCTTTCGGGGCTGCCgctgtctctgctgctgcatcggGGTCCATCAAGGCGCCT
ACTATCAAGCCGCGCTTCAACCCAGTGCAAGCTCAGTCTAATCAGTTACTCAACAGCGTAGAGGAAGCTGCGGAGGCCCCATTCGCCCAGTAGTGGCAGA
GTTTTTAATCGAATCATGGCAGGCAGTCAAAGAGTATTCTCTTTAATTCAGTTGTcggttcttcttccttccTTGCCCTGCCATACACCAGCCTATTCTG
ACCTAGTTCGCTGTCTTTCCTGGTCCCCCTTCCCTCGTAAATGCATAGCTTCCCTCAGCCTTGTCTTATCTTGCTTCTCACCCTCCTCACACTCGCTCGT
GGTCTGTAGATTTCGTTGCATGACCAGTCAAGCACGACGCAATCTTTGGTCTGGGTCTAGTCGGCTTGGAGCGGGAAAAAAAGAAAAGAGGCAACGCATT
AACAAGAATGACAGGCACTCCACTCCTGCTGCAGTCCCCCGCGGCAGAGGAGAAGAGGCAAACTGTGCAGTGCGTGCAGTACAACGCTGCGGCGCGTTCG
ACGAGCGAGATTTTTATGCGATCGCCTGCCAGCTCTGCTCGACGATCTCGCGCACGCGGCGGTTGTACTCCCGTCGGTTCTCCTGGAAGAGACGCGCGGC
CTCCGAGTTGGCCGGCGAGTTCGGGTTGGGGTCgcacagcagcgactggatgGACGTGAGGATGGCCGAGATGTCATAGATTGGGGACCACTGGTTCTGC
AGGATGTCCAGGCAGATCTGACCGTCGTTGtagactgcagcagcaacgacaacaatAACAAACATCGGTCGGTCAGTTAGCCACAACGACAATAATGACG
GTGCAAATTACGGCCGCGTAAGGTTTACGTACTGTTGGGGTGGAACATTTTGGTGATGAACTTGACGGTCGGCGCCTTATTCGGGTAGTCCTCGCTGAAC
TCGAGCGTCAGGTTGAAGGTGCCGCCTTCCCAGGGCGTGTCATCCGGTCTGGTATAAAGCAAACACACGCGGTTAGAGGCGAATAATACGCTGGAGGCGT
GGTCGTTCGTACCCGAAGATGACGGCCTGCCAGAGCATGATGTTGTTGTCCATGGGGGCGCCAGACACGCCCGACGGCGGGTCGTTCTGAAGCTTGCGGA
AGTCTCGCATTAATCGTCGACGCGCGGCGGTCGACATGGCTACAGGTGGACAATTACTGAGCGAGCGAGTGAGCGACGACTTGGCGCTTCGACTCTTAGT
GGCCTTTGACTCGGTTTGACTATggaagaaggaaaagaacGTCGGACATTCGAGAAAAGGTCTCCCCTCGCTAAAGCGATTGTGATCGATTTGACAAGGT
TTTCTTAAGTGCGGTTTAGTGCGAACTTCAGGTCTTGAAGCTCGCACGGCCTTTCGAGATTTGGATCGCGACtacctacatgtataatTGGCGAAAGATT
CGGCGCGCGGCGTCCGCTCGTTTGATTAGCATCGGACCAAAGGGCCAAGTGACAAGCATCGAGATTCCAGGAGACGCGGATGTCCACGGAGCGGCTGGTG
CCCGGCGACGGCCACAACCTCGTGGTGCTAGCCAGGCTGGACGCGACAGGCATGAAGACAGTGAGCGGCTACTCGTCCGCGTACGACGACGTATTCCCCA
CGGCACTGGACGGTATCAGTAAGTGGTTGAGATGCAAAGTGCATTCACGCTAGGGCCAACCCGCGCCTTCCGCTGTTTGTTCAAGACTATGTTGttgcca
tgttgaagtggagctTACGTCGGTCGTGCTTTATGTTTGCTGTCTGTTGTTTATGTCTGCAGTTTCACGGAGAGAGTTCAAGTTCTGCGTAGACGTGCTC
AATCAGACGGTTGAGGACTACTTTCCGTGCCTCCCATGCTATGGCTGTGGATATCTGTGGTGCTTCACTACATGTGGGCTATCGCTTTGCTTCTCGGAGC
CGTGCACCAAGCAGGTACGCGCGTCTTGAGTGTTCACCCGTCGTTGACATAttcttgagcttcagctGTGTCTACCTATTGTGATCTTGCAGCTCTCAGA
CAacttggagctggtgctgcgtcgaCTAAACAACCGAGAAGAACTACTTTACCGCGGTGTTGTCTGGAGTCTCAAGCGATGTCAACGAACACACACATCC
TGGATAGAGATCGCACAACTAGTCTACGAGTGACAACCGACACCAGTTTTCGCTTGCCTGCAACCTGATTGTCAAGCTGGCAAGGCATAGCCCCAGCATA
GGCTCTAAACAGTGCGTCACGAATAACATTACGTAGTGTACAACAGCATGGCTGTGTCCAGTTCTTCTATTGTCTAGCTCTATGTCTCTATCTATACCTG
ACCTGGGAGCAAGAATGACAACACCAAAGGAACAACGTCATGCGTCAGTCACATACTCCACACAAGCAAGGGTCAACTACTCTCGAACTGTTCAAGAGAT
TTCTTGATTGGTCTTACCATGATGCAAATAGGAGGTGCGTGACCTCCTATAAATATATACGAACCTGAGTGCTCGGTGGCCCTCCTTCCTGTTTACTTAC
GAGATCTTCAtccttcgccatcgccaccagtCTGCACTCACTCCGCTATGACACCTCTCTTGGCGTCACGATCAGCAGTCGTCTAAGTCATCACCACACC
TTCAAAGAGCACCACGCGGCtcttgttcagctccttgCACACTCtcttcatgttcttctcGCCAATCATCGTTACGTCGCTGATCTCCTGGATGGAGCGC
TTTGCGTTCGTGTAAGCTGCCACCAGGTAGATCACCGAAGCTGCTACAGCAACTGGAGGCTGTCCACTTGACAATTCCAGACTATctgccttcttcgcca
cAGTATGTGCAATCATTTGTGTTTTGTTCGGCAGACCCAGCCTCGAGCAGAAGCGCTGCACGTactcctccgtcgtcgcctgtTTGACTTCGAGATCCAA
GCGACGCTGCAAGCTCATAAAGGACTTGCCGATACGTCGCTTCGGGATTCCTGACGCTTCTTCAAACTCCTTCAGCGACCGAGCATTACCAGCCTTCCTG
CACGCGATAAACAGCACTGCGACCGCCATACTCTCTCGTTCAGGTCCTCGCATGTTGACGCCTTGTTTCTCAGCTTCAGCGTAGACGTCCAATGCAATTT
CTACAATCTTCTTCGGTAGCGACAAGTAGTCTGCAACTTCTTGAATACGCGCCATATTGCGCTGCATTCTCTTCACCTTGGTGCTGTCTGACGAGATATT
TGGTCGCTTGTGTTTGCCCCCCGGCTCGGCATTGGCTCCCCCACCACCCTTCTTCGGGTCGACCAGATACGTGGACAGCGAGAGGCTGTCCAGCCGCGTG
TCTGCGATGTCGCCGACCCTGGATTTCGCAGCGGGGTCACCACCCCGATCATCATTAGCAAACGTTCGCCATTCGGGGGAATCATCTATTATGCGCTCAC
CGAGGATCATGCCGCAGCTGCGGCACACGACGTCACCCGCACTAAAGTCCGTCACGACGTCCGCACTTCCACACTCACGGCAATGATCCGGCACGCACTC
GCCTCCCATAATTAATCACTGACTGCGCAGTCTCTTCTGAAGCTTGTACTGGCGTCCGAGCTCGTCCAACGGAGGAGATCTGGGGTGGGATCGAGagagg
agacgctggagaatCTAATGCGCCGTCTTCCCGGGTCAATATCCGATTGCTAGCCACACCCACGCGCCGTCGAAGCCGAACTCAAATGGCTAAACCTCTG
CGCCCTGTTGGTTGTGAAACTACTGCGATCCACCCACAAATATCGTACCTAATTGAGCATAATCAATGTACGAAACACTATGCATGCGTTTTGATGAGTA
ATGGTGTGGACACATCACTTTATTAAATTGCACAAGTCGCGACACGAAGCAGCGGTTGGGgagcttgctcttcttggcgctgtagacaacaacaaccatC
ACGCGAAGACAAGCTGCCCGCAGTCACAAATGCTTGAGGCCTCACGATCACGCCAGCCTTCGATTTACTGCAATTTTTCCCGTACAGTACGCGTTGCAGC
ACATTGTTGCCATACAGCCAGCAGCCAGGTCTCTGTCGCGTGCATCCTCTCCTGCACGTATATCCTCTCCATCCTGCATCGTCAGCCTCTCTAAAACTTG
AATCCCTTCTTGGAAAGGTCGGCTTTGGCATCAATCACTTGGCGATCCAGCTCCTTGGACGCCTCGGGGAAGTCTTGCACCGCCATGACCGACAGCGCGA
TCACCGCCAGCGAGTACGCGCCGAAGGATACGAGCGCGTACATGGGCAGCGCCGtcaccacttgcagcacGCGCGGGTCTTGCGCGTGATCGGACGCGta
ccgcagcagcagcagcagcagcagccacagcgcgagcagcacgacgaagacagcgagcCACTTCTGGTATTTGAGCATCTCGATGGGTTTTTTTCTATGT
GTTTGATTTAGACCTCAGCGCAATTCTTTTCGGGACGTTTTGACGACGACCATAGGCCAATAATATACATACAAATTTATGATTGGTTAAAACAATTCTG
TCCGGGATTAGATGGTGGAGACAGTCGTGATCTCACCGACGTCGTTACAGTGTCCATGACGAGCCTTCAGCAGATCCCGGAGCCCTCCGCGTTCATGCCA
GCGCCTCAGCTTCCAGCTGATACCAGCGAGATGGCAGATATTATCGAAGACAAGTCGCAGGGACGACGCAAACCCAACATgaccgacgacgagcgcctCG
TCATGGCcgacttcttgctcaagCACAGCCAGGGCGAAGCTCGCTTGCCGCGAGCAGTAATTACAGCAGCCGCAGACAAATTTCAGGTGCACCGCAACAC
CGTGTCGCGCATCTGGAGCCTgatgaaggcggcgctggacgtCGGCGCGTCCACCGACGTCGTgatgaagcaggtgctgtcgaagaagcgcggcAACTGC
GgacgcaagaagaaagacTACTCGGCCGCTCTAGAACGAGTGAAGCAGCTCCCTTTGAACCAGCGCGGCTCGCTACGCGCTCTGTCGTCGGCTGTGGGAG
TCCCACGCACTACGCTCTTTCGTCTGCTGCGTAACGAGGAGACGAGTGGTAGCACGAACGCCAATGAGCATCACGAGTCCAGCACCGAAGTCAAGCCGAC
GATCGCCAACACTATCAAACCGCCGCTGTCCGATAAGAATAAGAGGGAGCGACTGCGGTTTTGCTGCGGTAAGATGCAGCCAAATGGAGTGTTCGACAAC
ATGTTCAACGTGGTGCATATCAACACCAAATGGTGCTCGTTACCGGGCAATCGCGatacgaagaagaagaaggtcatgttcctcgttgctgtcgctcgGC
CGCAATGGGATGAagagcgtcagcagcagtttgaTGGCAAACTTGGTGTCTGGCCGTTCGTGGTGGCTGAACCACCCTTACCTCTTGGAACGTACACTGA
GGCCAGTGTGCTGGGTGTAGATCCAGCACAAATCGGGCGCGTATTccgcgtgctggagacgatcACGAAGAATGAGATCCAAACCATGATCACAAACTAT
GTCATCCCAGCGATCAAGCTCAAGATGCCAAGCTCGCTGCGCAACGTGCCGCTCTTCATCCAGATGGACAATCAGCAGATGCGACTAACTGCTGATGACC
CTGTTGTAGCGGAACACGGCAGCACAGGCGGCTGGAACATCCGAGTGCAGTATCAACCAGCTTACAGCCcagagctggtggtgctgagcCATAGCTTCCT
CAAAAGTATTTATCCAGAAATGATACCACCGCAACTTCGCAGCGCGCAGCTCCCTATTGTCGAAGAGCTCGTCGCTGGCATGGAGCGCACCTTTGCTGCG
CTGCCCAAACGACAGATTAACGACGCCTTCCTGGCTTtgcagaagacgatggagTGCATTATGCTAGCTGGCGGCTCAAATGACTTCGATTCGCAAGAAG
acgcgaccaagaagagccTGCAGCGCGACGGTAGTCTGCCCGTGAGCGTGTTGTGCAAGCGCGAAGCTTTGTTGACCTGCCAGTCCATCTTGAATGCCCC
GCGGGAGTGAACAGACTGAGACTATGGGGTGTGTCTGGTAGTGCTCGTCATGATTGTTCGTTTCGTTTTGAATCAAAGTATGTAAGTAAAAGCCCGGTGT
TCAAGGCAAATGCAACAAGCGCAATGAATGTCTGACGGACTGGGGGGAAAGGCCTGGCACGTGATGGAGTATTTGCACTCAGGGTGCTTCGCGGTGGAGA
AGTGTCGACGTGTCAACTGCTCATATCCTGAATCACTCATCTCTTTCAGCTTGAGGGCACTGGGCGTGGTGCACGTTCACATCCGTGTGCAGGAGGCGTG
CCAAGTGTGTTAAATAAACTCGGAAGATGCCAATGAGAACGTATAAATGCAGCAGCTAAATCCACTCTGAGCCTGCGAAGCTAGGATTATGAGAGTTGat
ttattataataataccGCTCTAAGAAAGAATAAACGCCACTCGTTGATGCGCCGAGAGAAGAGGATGAGAACGAAGCGTTGACCATTTGCTAGACTGCGT
GACACCAACTCAAAACACaggatgttgaagttggacCGTGTGCACCACACAACAGGGGCATAAAAATCACTTTTTAGCCAATGAGAAGGTCGAGGACACA
TtgcgtccagctcgaactGTCTCCTCCACCCACTATCAAAACCAAGTCACTCAACGAAGATCATCATGGCCGAACTTCCGCCGAGTCCCGTTCCAACTCC
AGCTGCAGAGCTGATACCGGAGATTCTTCTCTCCGCTGCAGAGCCTCCAATCGCCACAGAAGCTCCGActgcttccacttcttcctccgaCAAGAAAACG
AGCGCGTGGAAGGAGCGCGGCAGCAAGAACTTGACGTACGAGGAGCGTCGCGCCATGCTGGACTTCCTCATGAAGAGACGCGTCGAAGGCACCTCGAAGC
TGGTGCGTCATGCCGtcacagacgcagcaacCGAATTTCGCGTGGATCGCCGCACCGTCTCGAGGCTTTGGAAGCGAGCGGTGCAGAGTCTCGAGAATGG
CGACGAGGTGTGCGACGTCGCGTCGCGGAAGGTTGGGCGTCGCGGCCGTCGGAAGCGCGATTGGTCGGCGGAACTGGAGCGCGTGAAGGAGATCCCATTG
GCCCAGCGAGGCTCCATCCGGGCGCTGGCTACGGCGGTCGGCATCCCGAAGACTACGCTCTACGAACTACTGAAGGAGGACGGAGGTCCGACCATCAACT
CGATCAAACCGTCGCTCACGGACAAGAACAAACTCGAGCGACTCCGATATTGTGTGGACAAGGTGCGACCCAATGGGTTATTTGACGACATGCACAATGT
CGTGCACATCAATATGAAGTGGTTCACACTCCCCAGggacaagaagaccaaggTCATGTTCATGGCAGCGGTGGCGAGACCGCAGTGGGATCCGCAGAAG
AACGAGTACTTTGACGGCAAGATTGGCACGTGGCCTTTTGTGCGAGAAgagatgcagatgcaggaggcAGAAATGAAGCTCCCGCAACAAATACCAGAGC
GGACGTTTGTTGCGCTAGAGACGGTGATGAAAGACGATGTGCAGCGTATGATCACGGAACTGATTGTCCCGGCCATTCGGCAGAAGATGCCGGTGCACCT
CATGCATGGTTCTATCTACATTCAGCAGGACAGCGCGAAGATTCGGTCCTCTGGTGATGCGAcgtttgctgaagaaggacgaaAGGAAGGCTGGAACATC
CAAATGCAGAACCTCCCGCCGTATTCCCCGGACTTCGCGGTGATGGATAGCGCCCTCTTCAAGTCAATTCAGGCTGCATTGAAAGCAttgccgccttctt
cgctCGCCGCGTCGGTGTCGGGGCTCACGGAACTGATGTCTAGTGTGGAGCGGGGGTTCGCTTCACTGACGAGGGATCAAATTAACGACGCGTTCCTGTC
GTTACAAAAGGCTATGGAATGTACGATGCGAGTTCAAGGCTCTAACACGTACGAGCTTGGCCCTACTGGCAAGGAACAACTCCAATTCGAGGGCAGTCTA
CCAGTAAGCATATTGTGCGACCCCGATGCAATGTTGGCGTGCAGAGCGGTGCTTGATGAGGCCACTGAGGAATCCCTCGAAACTCTCTAAAAAAGCAATG
GCATCGGCATCGAATTTTGCTACGCACCATTATACTGGAGGGCATGAAAAGGACGAATGCTAAGTCGAATCCAATGTATTTTATTGATTCATGTCTTGGC
TTGAAGAACGTGGGGCCACCTAGCAGATGGATCGTTGGCAGAGCATCAATGAATCACCCATTGCGGTGAGTCGACTCGTACTCCTGTTCGTACGAAATGC
AGCGCACAAGGAAAGACTAGTGCTCGCATCTTACGCAATGAAAGGCGCACCGAGGTTCCACGCAATGAAGGCAAACACCTCGGACGTCTCCTCGATGATC
TTGGTGGTGGGCTTACCAGCTCCGTGACCGGACTTCGTGTCAATGCGGATGAGCAGGGGGTTCGTCTGCGCCTCTGAGTTaccgagctggtgctgcagct
ccgcaATGAGCTTGTACGAGTGCAGGGGCACAACACGATCGTCATGGTCACCTGTAGTCAGGAGCACCGACGGGAAGCCACCACGTTCTGCGAGCTTCTG
CATGATAGGGCTATCAGCGTGCGGAACGTTGTGCACCGGCGAGTAGCGCCGAATGTAGTGAAAGTCGTCAGCCACGTCCGGGTCACCGTAGTCCGTGCGC
CATGCGTGGCCAATGGTAAATGTGTGGAAACGCAGCATGTCCATGACGCCCACAGCTCCAACCACGCAACGGTAGAGGTCAGGACGCTGGTTACTGGTAG
CTGCCACCAGTAGCCCACCATTGGACCCACCGTGGATAGCGATCTTCTCCGGGTTCGTGTAGCCTTCCTTGATAAGGTACTCGGCAGCACCGTGGAAGTC
ATCGAACACattctgcttcttgtgcagcaTGCCATCCTGGTGCCATTGCTCGCCGTactcaccaccaccacgcagGTTAGGCAGCGCCAGCATACCATTA
AAGTGCTGGACGAACACGAGTCGTGAGACGCTAAAGGCCGGTGTGAGCGAGATGTTGAAGCCGCCGTAGCCGTAGAGGTACACTGGTAATTTACCGTTCT
TCGGCGCGTTCTTACGCTTCACAAGGAACATAGGGATCTTCGTTCCGTCCTTGGACGGGTAAAACACTTGCTCTGCCTCGAACTGACTCGGGTCAAAGTC
CTTCACCTTAGTCTCACGGAAGAGCTCAGCATCAGGAGCCGATCCTGGGGTTGCTCCCTTCTTGGACAGATCAATGCGGAAGATAGACCCCGGGTACAGG
AACGAGATGAAGTGGTAAAACAGTTCGGACTCGGTGCGCTTGCTGGCCATCCCAACAGTGCCGACACTGGGCAGTGGAATCTCGTACTGGAAGACACCAT
CAAGGTTGTACACGTGCAGTTCATTGTGCACGTCCTTAACGAGCTGCACAACCAGCAGATTCGGCGCCACAGGATGCACGCCTTCGATCACGATGGCATC
GGGCTGCTCGGGGATCACCTCTTCCCACACAGGCGCAGCACTGCCGTCGCCCAGCTTGGTGCGCACCACCCGCTCACGCGGAGCATCGGCGTTGGTCTTG
AAGTAGTAGTAATCACCGTCGTTCAGAATGTACGAGTACGCCGCGTCCATGTTGTCGACGAGTTTCGTGACCGAGATCGTCGAGTCGCTCGGTCCCTTCA
AGAAGTTGTCAAAATCGCTCAGATCCGCGACGTGGATCATGTTGGCGTTCTTACATCCGTCCTGcacgtacagcagcagcttcttgccatcATCTGAGAC
CTCCGCCCCAACATTAAATGTCGGCTCACTTGGGTAAGCGTATACCAGTTTATCCTGGGTCTGCGGCGTGTGCAGCGTGTGGTACCAGAGCTGGTGGTTC
ATGTTGGCGTCCGTCTCGGTTCCTCTCTTCgggccttcttcgtcgtcgtgcttgtCGCTTTTCATCTTCTCCGGGGGAGGGTACCGCGAGTAGAAGAAGC
CCTTGTCGTCGTGCGTCCAGGCGATGCTCGAGAATTTGACCCACTCCACcgtgtcgtccagcatcttgttgtcgtcgtgAACGGCCATGACTTTGATGGT
CTGCCAGTCCGACCCACCGCGGGACACGCCGTGGGCGAAGAACAGCTTGCCATCCTGCAGTTTGGCCTCCGAGAAGGCGCGACTGGAGAGAGCCGCCGTG
CCGTCAGCTGCCAGTAGGTtcgggtccagcagcacgcgcgcctcgccctgcagctcgtcctggaTGTACAGCACGCTCTGGTTCTGCAGCCCGTCGttct
tggagaagacgtacTTGCCCCCGTGCTTGCGCGGTGCCGAGAACTTCTCGTAGTTAAACAGTTCCGTCATGCgcgtcttggtctccgcCACGAACGGCAT
CTGCTGGCCCAGCACACGCTGCGTCACGTCGTTCTGCTGCGTCACGAACTCGCGCGTCTCGGGCGTGTCTGGGTCCTCCAGCCAGCGGTACGGGTCCTTC
ACCTGCACGCCATGCAGACTCTCCACCAGGTCGCCGCGGCGCACGGCCGGGTACGtcagcttctcggccagcAAGCCTGCAgtcttcatcgccttcttca
tccaggGGGGGATCCTGcaatgacgacagcgagttgAAGACTGACGGCGTCATATCATATGAGAGTGGGACGATACATAATGTCCTACCATTTGTATAAT
CTTTTGATTATTAAGTCAAAACATTCACTCCATCACATCTTAATTTTTGTTGAGTTATGATAATTATATGATAGCATAGATCACGATCTGACAAATCATA
CTGCCACTCGCGCGCCATGTGGAACCAGGCGCTGCGGCGCGTCGTGAGTGCCGAGGAGCGGCAGCACGAGgagcgtcgtcgacagcagctagcgcgagct
gcttctgcagcgtcttccgCGTCTAACACCGCGACTCCGAGCTCAGAAGCCCCCGCAGAAGCTTCGCAACCAGCCTCAGAAGGCGACAACCCtgcgactg
caacagcttctgTCGCTTCTAGCAACGAGAACAAGGCGTCAGAGCCCAAAAATGATGTCGCGTGcgtagaagaagaggaagacgacgacgactaccTGCA
GAAGCATCTGCTATCGCGTCCGACGTCGGCCTGGAGCTGCCTCGAGGACACGCAGCAGGCTAATTGCCTGGCGCTCAACCCGTCGCACACGCTCCTGGCG
GTGGGTGAGCGCGACGGGCGCGTCATCATCTGGGACAACACGACCATCCGCGTGATCACGCGGGAGCTGGACCCGACGCTCATTGCGTTGCCGGCAGTGG
AGGTGCCTGAAGGTGACAACGACAAGAGGAACGGACAGGATAGAGCGACTGTCAAGACGGACAGTGGAGCTAAGAAGACCAAGACAGATGCAGAGGGGTC
AGtggagaacgacgacgcGTCGGtggaagatgaggaggaggaggagaggacGGAGGATGCGGCGTCAGTTGAAGAGGACGTGGCGAcggaagaagatgac
gacgccgacgcagAGGAGGACAACACCCAAGAGGAGAGTGAAGAGACCAAgacggaagatgaagcggaCACATCAGGGGGTGCAGCTGTATTAACGCTGT
CGGATCTTCGAGTAGTGAAGACGGCGCTGAAAGTGGTATCGCAGTGTGCGTGGTCGTGTGACTCGCGGTGGCTTTTTGCAGGCTGCGAGGAGAAATCGAC
ACGACGAGCGAGGTTGTGTGTCTGGAATGTGGAGGCAGCGACGCTCGTTTCGGCGTTTAGGTTTGACGGTGCGATCACCTCCTTGAGTGCACACCCTCGT
GATCCGAAGCTGGTAGTCGTGAGTTATTGGAATTCTCGcccggtgctgctggatgtcgtCTCTGGCGAACGCACAGAGCTGGAAAGTGTGTCGCTGGAAA
ACACCGAGGTCACCCAACCAACGCCACAAAGCAACTCACGGCACCCTGTGCTGGCATCTTGCGCGCGATATGGACGTTCAGGGAAGCGCATCTACTGTGC
CACGTCGAAATCAACGCTGGCGGTGTTGGACGCTGCTACTTTGCAGTGTCTTGACAGCCTCAAGTTGAACGTGATCGTCCAGTTCGTGGATCTGTGTGTG
AACTTGCATGAAACGGCAATGCTACTCACGAGTTCGAAGGGAATTCACGAGTTTGTCATGGATTCTGCCGTAACCTCAAAGGATGGCTCATGCGAAGAGC
CCGCTATTGCGACAGAGGAGCACCCAGTAGGGCTGCGTGAGGTGGCACTACACTCAACTGGTGCAGTGCGTGCACCTTGGGCTGTTTGCTGCTTTAGCGG
CGGCGAGGAGTTTGTGGTCGGAACACCTGTGGTGCGCCATCGGCACGTAGGCGAGAACGGTTTGTTCACGTGGCATCGTGCCTCCATGCTAGGCAAAACA
ACGGCTCAGCACAACGTCGGAGTAAAAGATGgcgtgctggcgctgtcttGGGATCGCGCAAGACAGAGTGTGCTAGCTGTCTCTACCAGTGGAGCTTTGA
ACGTGCTTGAGGAGCAATTCACGACAACGTGGCCAGGGGCGATGTATCCTGCGGGTTTTCGTCTCATCACTGACAACGAACTGCATCTGGAGGTGTTCGA
CCGTGACGCAGAAGAGCGAaaactggagaaggagaaactCACTGAAGCTGCTAAGCATACCCCCGTTGATGTGTTCACTGTAGCGAGTCCAAGTGCCGAA
TTTCCTGGAGAATGCGACGTTGCTGGCGCTTCGCTCCCCAAGAGTGAAGTCGATAAACTGTGCTACATCCCAGCCATCCCGATTGCATATTACCATCGGC
GCCATCTACATCAACTTCACGGAGGAGCGTACAACGAAGATAAGCATTTCGGTCTCGGCCAAAGCATTTTCGAGCCGCTCAAGGGTGCGCTGGGTAAGCA
AAAGAAGAGCAACGCTCGGAAGTCCAAGAGCAGTGGCGGCAGCAATAGGAACCAGAAGCGGCGGCGCAGATAGAAATCCAGCCAGAGTCATATCTACCGT
TCAAATACCACGCTTGAGGTGCTGAGCGTGGGACAGGTAATTCGTGAACTGATGTGAAGTACCTTGCAAATTATCTTCTGCCTTGCTGTACAGATGGTGT
TTCAtttggcagcagcgctgcctcGAGCCGTTGAAGCGACGGCGTCAGCGCACAAATGCGCATGGCATCACCCTTGGGGCTTTTGATCGAAGCAGGCGCC
GGGTTTAAGTACTGCTGGTCTTGGTTGTtactgtcgctgctgttggatTGAAGGCGATCGTCAACTATGGAAACTCTCGATACCTGCAGCGCTCGGAGTG
CGATCGAATCGACCTGCAGCCTTCGACGTGCGGCTGTCCTGGCTGGGCTGGTTGGAGAGAGTTGCTGGTGAACAGGGATAACCTCGCAGGCTTCAGAGCG
ACGTTGGGTGTGGGACTGTCGTGCTTGCTGCCTCGCTGCTCGGCTACCTTCTCGTGACTTCCACCCTCTTTTATCCAGCTGAAACatcgatgaagctgca
gattcGCTGACAGGGATGTCCACACGCACGCACGATGATGACGTGGACACATGCCCTGCCCAGCCGCAGCGCGAACACGTCAACTTACTACGTCGCTGTG
CTGCCAACGTTAGCCGTACAGCATGTTCGCAGCCTTCAGCCGTGAACTTTTTGCGTTGAGCTAAAGCTGTGGCTCTCCGCAGCTCGAACCAGGACTTTCG
GTGAGCGATCCATTCATGAatcagcttcagcgacgGTGACTCTTGTGCTAGTACCATGAGTAACACCGTTGAGGGCAACGCGTAGGCTCGTGCACCATTT
GGTGATGTCACGGCGCAGTATCGCTCAAAAGATGGTGTCAAAAACAACACCTCGGCCAGCCCAACTGAATCGTGAGCCTGCAAAAtttccagctccagat
cTGCTTCCTCTCGCACTCCAGGGCGTTCTTCGCGAGGAGCTCCGAGAGTGAGCTGTCCGGAGATCACGATGAAGAACCGCACAGGTTGGCCAGGTGTGAA
GAGGTACTCTTGTTGCGCAACGACAACATGGCTCAAATGCGCTGCTAGAAAGCGTCGTGAAGACTCTGCCATAGATCGAAAGAGGAAAGTGTTGCGCAGA
AACACCTCGGCTTCTGGTGCAAAGGAGTACGGGAAAGCTGGTGGCAGGTGAACGCAGCCATCTTGATGCCggcgttgaagaacttggagctgctgaacga
ccAGATACGGCAAGCAAAGCACATAGGTGAGGGCTGCTTCGCGCAGACCAAGGAAATTGCGCTGGCATGCACTGCCCGCAGTCACGGTTGATAGAAGGTA
TTCAAACCCGAATGCGGCTGCGTCAAGACCGAAACAATCGCCCGCAGCAAGCTCTCGTAAGTGCATGATGGGGTGGTCACTGAATCCTAGCGCATCAGTG
GACATCCTAGGCAGAGTTGATGCAGTTAACGACATCTTTTCGTCTCGCAGAAGCACCAGCCGGAATGAGAGCTCGCAGTGTCCGTTGAGAAGGAAGTACA
CACTCTCGGCACGTACGATACTCTGGGTCGCGATCGTCTCGCCTGGTGCCGCTGACAACATGGTCACGCGTCGGAGCATAAGCCTCCAGGCCTCGTCACA
GTCGGCAGCTCCCTGTTCGTCTTCAGCGCTGTCtgtctcctcttcatcaattCTGCTGTTGCATTGATTGGCAGTTGACGCGTCCGGAATGTTCTCCTTC
GCTGCTTGTGCGTCGATCATACCCAGTGTCCGGAGCGTACGCACGAGCTGTGGGAAGTGCTGCGATAGCCACTGCCGGAATTTCGCCACTGCTCTCGGAT
CTTGTCGTCGTTTGCTACTGGTCTCCGgactctgcagcagcagcttaaAACATTCGGAGCCACTGAAAGGATCGAACGCTACGGACTCGAGCACTGGTCG
ACCTCGACAAGGACTCGCGACTCGTACGATCGACCCTCGTGGTCTAGTGGGCACCACAGCGTTAAACCCCCTTCGCTCTGCAGGCAAGGAggctgctcga
gctctcgGTAGGAGCACAGGCGCAAGCTCATGCATCCTCAAGCgatatctacatgtacccgTACGTGTTTTCGGCGTCGTGGCAGCCCGGACATCTCCCG
ACATGTCGACAACCTGCAGAACGTGGAGTGCGTGAGCCTCGCTCTAAATCAAGCAAGAACTATTCCCAATTTACACTTTACAGCCTCCACCTGTTTAACT
ATTTATAAGACAGATTGAGAAGGCGATGTGAAAAGGGTGCGTGAATTTCATAGTTTATTCGTGTAGCTTCGGCCGGAGCCTTGGCCACTTGGCACTGCCT
ACTGAGAGACAGAGTCTCTCCTGCTGCTAACAGACGCAGACCTCGAGGGCTTGACGCGTGTTGTGGTTACTTCTTGCCTCCTTTCTTGCCACCCTTCTTG
CCAcccttctcctccttgggAGCTGCACACACAACAGCAATACAAACACAATCAGTCAGAGCCTGCACTCCCAGTGGCAGCATCGGGCGATGACTCACCG
TCCTTGGCGgccgtcttctcctccttgttgtCTTTGCCCTTGCCCTTGCCCATGACTGATGGAGCGCTTGCTGCTTACTTGGAGAGGAACTTGGTGGCTT
GAGCTGCGAGCTGGAAATTCGAGAATGAAGCTTTTGCACAGGCCAGCGCTGGCCAAGGGAAACTGACCGAGACGGTGAAAGCAAGGGACGGACGTCCGTT
ATCAGACAGAAGCGCGTAACGGCTCAAAGcacttggtttttgtatggtCGCGCGAAACGGCTAGAATCACTGTAGGGTCGAGCGATCTTGAAGCGTCGCA
CGGTTGAAGCAGACTCATTCGGTGGCTCGGCGGAGTCGGACGGTGACAGAAAGTGTGGCGCTAGCCATCGCGCGCGATCCATGCATCTGCCACTAGCTTC
CGCTGTCATCGTTCgagatggcggcggcaaTTAGATGCCCGCGGCGGCTTCGAAGCTTCATGCTGCATTGATACAATGAACGCGGCGGGAATGCTTGCAA
AAGCTCAATTGTcttgaacttggtgctggaaaTTTGAGATGCAAAATGCTACACACACGTTCACTTAGAGTGCAAGCTTGTTGAGCGCTTCCGCGAGAGC
CTGGACGGCCTGCTGGCTGATCGCATCTAGCCGAATGCCTGCAGCGCGCTTTGACATCCCCAGCATGAAATCGGCGACGTACACGCGCGTGCTGTCGAAG
TAGCGGCAGGTCCACGTGGTCATCTGCACTTGGATTGTCGACGTCTCTCTCGGCTTGGCCTGCTTCAGCGACTGCGCTTTCTCGTGGCTGTACGCCATAC
ACTTGCGGATCAACGCAACACCAGAGCGAGGCTTctttcgtcgtcgactgcCGCTTCGATCggtaccagcagcttcctctcGTCGAAATGAATCAGTTAG
AACCTCTCCCAGTCGACTTTCGTCGTACTCGAGCACAGGAACCACCAGGTTCACAAAATCCAACATGAGCTCGACCTGCGCTGCCACTACTCGCTCAGCA
TCGGCATTCCCAGCGTTATCATTGTCCTCGCTTGGCTCGCCTAACGCGTCGATGTCTCGCGCCACTTCCTCAACAATCGAGCTGAAGCGCGCCTGCACTT
CGTTGTAGAAAGCGTCATCACCACCGTAGAGCACGTCGTTCGAGTCCACACCGTCCAGACGACCTGGGAGCGACCTCTGCCCCCACAGAGCATAAAGTTG
AGCaagcatgagcagcacgcgcacACGGGCGACAGCCGCTTCAAGTCGATGTgacagcgaggaagagctcggTGGCACCCACGCCATACGCTCCAAAACA
GCTTTGCGCAGCGCAGTTACAAAGTAGAacgcgtcttcgtcgtttaGCGATGGCGCATACACCAACACGCTCATCAACTGAGCGATCACTTGCACGACCT
GGTCGATGAcattgctggtgctgttgatACCCACTGCCCCAAAGAgtccgacagcaacagcgcgaCTTGGAGTGTGGGAAGTCATTGAACCCAAATCTTC
ATCGTAATGGGTAGCAGATCGAATAGCGCTTGGGTCGAGGtctgcgagcagcacgatTGCAGCTTTCACCAACGCGTCCATCTGCGGGATGCAGCTCGTC
ACCAACGCTACGttcgccgccgacaccaTGAGTTGCAGCTTTTCAAGCGGGGCCCCAATCGATGGAATCGTGATGTGCGCGAACGCCAAGCACGATTGAA
TAAAGTTTCGTCGCACATGTGCTCGCTTCTTGCCCCCAATCACCGACGCTACGCCACCGCCGATACGCTTGTGAACGTGCATCGCTAACCGGAGAACCAT
TGTGGAGAGCAGCACCTTGATCGGCTCCAGCTTGTAGAATGCACGACGACAGTCTGTGTAAAGCATGAGCAACGCCTCCTGTTCCTCTTCTTGTGCTCGT
TCACTCGCTGTCGCGGCGTCGTTTACGTATCCGAGCCGCGTGATGAAGGCCGATATATCGCGGTTAGCCTCGGCGCGCTCGGACGCAGTACTGAGAGAGT
CAAGTGCATCGTGCACGCGACAACATACAACCAACAGAGTGTGCGCCACAGCAGCCTCTGGACCAACGACGTGGAGCCGTAAGGTGCCGAAACGGTTGGA
CGACTTTTTCATGCTCCCTCCTACAAAGGCTCGCAATACTTTCTTCGCCACATCCACACTCGATTCTCGCTTGAACATGCCCATGAGAGCCTAAGTACAA
CACGAGTTCCGCGTTAGCGCCAGAAGGCTGTGCAGGGTGTTGATTTTTGTAAGCTGTCCGGATACTCACCAagaacgacgtcgacggGATAagcttcgag
aagaactcgTAATGCTGCTTGGCGCCGAAAACAACGTTTTCAATCAGGGCACCAAGCAGATTGTACGTTTTCGCCGTGAGCTCCTCGGGTGTTGCTGCGT
TGAGGTGGCGTACAACATCTTTAAGTAGAATGAGAGCCTCTCGATGCTATTACCATAAACAAAATTAACAACGTTAGTTTTTccagtaccggtagtatGA
AATTCTATCAGTCGTCGTACCGAGAAATGAGCCACAATGAGCTTCATgtaagctgctgcacactcCATATACTGCGTGATGTCGTCTTGAGAAGTGATGG
ACGACCATGAACCGTTTAAAAACTGCAGCTTCCCGCCTGGCTCATTCTCCGCGACAGCAGGCACGTTGCTTAGCTGCACCGCCACAAGACTGTAAAGATG
GCACTTGGAAACGagagatggagacgctgtgCGAATTAGGTCCAAAATCTCGGTGGGTGTCGACGCGTAAAACTGAGCACCAAAACACTCGCACAAGTGC
TTCAGCACCATAGAGCTGTCGGAATATTCTTGATAGTGTGCCAACAGCGTATCAAAAGTGTCCTGAGTGGCCCCTGGAGCTGCACATTTAACGAGCCACT
CCACGGCAGGTGAATGTAGCGCCAGATACTCTTCGTATTCCATCTTGTGAGTAAGCAACCAGTGCTCAAACTTGCTTTGGCGGAACCAGTTGAACGCGTA
AAAGTAGTCGAACAGACTGCTGCTCACTACGACAGTCTGCTCTGCCGGAGAGGtggtgcccagcagctccgaaCTGGTTAACGCCAGGTACAGACGCGCG
TATAACGCGACCATGGGTTCTCCAACACCTCTAAAACAATTTGCAGAGAACATGATCATAAAACGTAGCGTTAGAAGCACAATTTCCGGCATGCTTTCCC
CGAGACAATGTCGATTACATACTTGATCATGTTTGATAGCCGTGCTACAATCTGCGGATACTCGCCATCACAAAGAAAGCGATAACACCCAAGCAACGCC
ATTTCGATGTAACTGGGTAAACAGTAGGCGCAATGGTTAGACAACGACAAATGACGGCGAGCTTCCAGCCAACCACGTAACTTACATTCGTGGAAGAAGC
TCTCGGATGCAAGCCGACTTGTAAAACCAATTGCGACACGTTTCAGTGGCTTGGATATTGATGTCCGAGCTCATAAAATGCTCTCCCAGTGGCTGTGGAA
GAGGTTGACCATTTTCATCCTCGGACGCTCGCGCGTGGATGCGATCAAACACGAGCTTGCCGAAGGCATCCAGCACTTCACTCACCAGCACAAACACACA
TGGGTACAATTGGGGTGTCGTATCAGTGTCCGCAAGCAGTTTTACGCACTTGATAGCAATGCGTAGCGCCTCCACTTTGTGGTTATGCTCCCAGCTTGCG
ATCAGTctcttctgcatcttcttcaccttggccacATACTGACTTTGCGAGATCTCGATGGTTTGCTCATCTTGTTCGGACGAAGGTCCACTATTGGCGG
GGTCAcgttccagctgctccagtcgtGCACGTGTTTTCTTGATCACCGACGCCTCTACTTGATCGTCTGCTTTCTGATAGTCGCTCTTTGGAGCGAACGA
GATCTCattctccagctcgttcacTTCGAGCATACTCGCCTTGATCTTGAACGTGTGGTCTGCATATTTGGCCAGGAGTCGGTCCGTGTGCTCCTTCCAC
TTGTGCTTGACTGTACTCGgcattgcagcaactttATCTGGTGCTTTATGTGCCTGGATCGCATCAATTGACGTCGATTGCGAGCGTCCAGACTCAGATT
CCACCGTCTTCACGCTTCCTGACGACCCGAGGACTCCCAGGGGGTCcacgtctccatcttgcagcaccacgagctccGGAGACACTCCACCACCGCTTTT
CCTATTGGAGAACGAGTCGCCaagagctgaagacgcagaagTAAGCGGAGGGCCCACTGCAACTGTCGTTGTCTTCGAATCCACGGGAACTGCCTGCTCC
AGACTGGAAAAAGTCGTTGCAACAGCCAACGGATGCGCCTCCTTAGCAGTTAAACCGCGTGATGCCAGCTCATGACGTGATCGAGGCACTTGTCGCTCTC
CCACGCGCCATTTGATGGCAGGAGTCGCCACCGGAGACTCTCGTTCCGTCAccgccatcgtcatcgtcatctgCTCTTTGAAGCTGAGAATGGTGGATCC
GCTCGTACTTATAAGGAGCAGATTAGATGCTATGATTGGTTACATTTGATGTATCTTTTCAACCAATCGTAGAGTTTGAAATTGAACGCTGCAGTGCGCG
CCAAGCATCTGGAAGGACGAGCCCGAGCAAACCCGTCGTGTCTCCGCTAGAAGCCGCCCCCCCGCGCCGCTGACAGGTAATACCCGCTCTATCGTTAGTG
CACTTATATAGAGGAGACGAAGGCGCACAGAACGAGGTGTTTAAACGCATCTACTTCGATCTGGAAGCGTCGGAATCTTTCCTCGAATAACTGCCACATA
TCGCTCCAGTTCCTCACTCACTCTCGGTGTGTCTGTGTGCTGTGATCATTCAGAAACATTTAATACATAATCGAGCTCTAGGATGTTCGGAGCAACTGCA
GGAGTGACGCAGCCCGCGGCCggcggcttcaacttcggcgGAGGTGGGGCAGCTGTACCTTCCGGTGGCTTCGGTTTTGGCGGAGCTGCGACGTCTACGG
CCCCCGCTGCTGGCTCGACGGGGTTCAGTTTCGGTGCTGTGCCGGCGGCACCTGCAGCCTCCAGTGGTTTCTCCTTTGGGGCTGCACCCGCTGcggcacc
tgctgctggtagctCTGGATTTAGCTTCGGAGGTACCaccacagctccagctgctggcggcggcggcggctttAGTTTTGACGGAGGCGGAACTCCCGCG
gcacctgctgcatcgaGCGGATTCAGCTTTGGTGGAACGAGTGCGACCCCTGCCGCTGGTAGCTCTGGGTTTAGCTTCAGTGGCACGGCGCCAGCTACTa
gcacagcgtcgtcgttTGGATTTGGTGGTGCTTCGGCTGCGAAGCCTTCCCTCTTTGGTCAGCAACCTGCGGCGACTGGATTTGGTGGCGGCTTTGGCTT
TGGAGCTAAGCCTGCGACAACAGGCACAGGTTTTGGGTTCGGCACAGGCACCGGCACAAGCTCTTTCGGCACGACTGGTACAACAGGATCGTCGGTCTTT
GGCGGTGGCGATTTTGGCACCACATCTGGCGCAGCGCCTTCTGCATTTGGTGCTGCTCCTGCGGCCTCGACTACTCCAGCCCCGATCATCCTGGGCGCAG
ATGCATCTGTTGCTCAGCTGAACACAGTCAAAACAGCATATCAGGACCCTGCACAGTCGCGTTTCAAGTTCCTCATGTACAACACGGTCGACCCGACGCA
GCGGCACCTGTACGTTCGACCACCACACATCAGTGAGCGCCTGTGGAATCAGGCAGAGCTGGACAACCCAGACCCGCTCAACTGCGCACCCGTCCCTATC
CTGGGCTTTGATAACCTGCTCAAGCGTATCAAggcgcagcaggagcacgCTGAGAAGTACAATAAGTACACCGATGACCTGTGTGCGCAACTCAATGAGA
TGGACAAGCATACGCGTGCCACAGAGGAGAAGCTTGAGAAGTGCCGCCACGAGCAtgtgcagctcttccacgcACTGGTGAAGGTCATGCGGGACAtcga
gcttctgcagaaCTACGGCAAGCCGCTTCAACGCAAGGAGATGCAATTGGCGTACGTGCTATTGGTCAAGTAGCCATGTACACCAATTGAGCCTAACTGG
GTATGTGTATGGTGGATAACAGGATggcgttgaagaagctccagACGTTGCTGGACTCGCCAGGCCAGTACAAGGCACGACTAAACGACGCTGTCTCGCT
CCAGCGTGTTCAGAAGGAGGCACAGCCTCCTCCGACGAGTCAACTCAGCCCGCAGGACCTGCAGCGACTCCATGAGGTGCGAACTCGTGGTGATGGGCTC
GCTCTTGTTGCTCTAACACATGCTTGCGTATTTATTGTGTGCATCTTGCAGTTCATGAATAAGCAGCGACAAGGGCTGGAGCACCTGACGAACATCATTA
ACGACGATCTCGCGGACATCCAGCTCATCAAAGAAACCTGGCGACGGTAGGCAGGCCACACCCGTTCAGTCATGCTACCAGTCGCAGCATCTTGCAGATG
GATATCGCATGATGCGGCGTTGAGCAAATGCAACGAATGAAGAGAAGAACAAGTATTTCCAGTAGAAGAAggtgttcttcttctcagcgGCACCCTCACA
ATTGCAATCCAGCAACTAACTTACTACCAGGCAGTTTAGTCAAGGAAGACGAAAGGCATTATGGCAATATATAGCTAGAGACAGCAGCTGGCATGCATGT
TCGCAAAATGTTACCAATTGTGTGTTGTCTTTTGGTTTCCTGACTTATGAATTTGGAGCTGCTCTAAGCAGATCGGCTCCGTTTTCCATTACTCTCCATA
CTTATGCATGCCAAACAAAGTCGCAGCTAGTGCCAGGACCGACACGACTGACGACGAAGTCTCCAGACGACATCCTCTGATCTAGTGGTACGGGTCCACG
TCGCCGTAGGTCTCGATGACCAGCGGGGCCTCGTCGAACTGGTGAATAGGAGGGGGCGACGACAGGCACCACTCGAGCGTCTGGTGCACCTCCGGGATCA
CGACCTGGGCGTCCTCGGTGGGCGTGTTCTGCTCGGGGACGCCGTGCACCTTGTCGTCAGTGGAGAAGCGGGCGACAGCGGGGCGAATGGCGGCCGTGGT
GTTCACTGCAGAGAGGGGAGGAGGCAGCATTCGGATGAGGTGAGACAAACTGCGAGATCTCGGCCAATTCGGCTCGATTTGGCGCGGGAAGAACGTGCAC
AGAGAGAGGAGAAAGAATAGGAAGACATACCGGCCTTCAGGGCGCGCATGGATTGGCGGATGAGGCTCATTGTAGCGAGTAATGGGCTTCCCGGCGGTTT
TCTTGATCCGGAAGGAGCTCTTTGAGGACTGCTCTCGTCTGGCGGCTAGACCCCAACACAAAGACAAGAGACTTTGTGCGGAGGAGGGGCCGTCCCTTAT
TCCGCAACTTGCCTCGCTTTATTTAGGAATTTGTAAGTGGTCTGGTGGTCAATCCACACCCTTTTGGGCAACTGAATGAATGTCCGGGGACAGCAACTTC
TCTACTTAGTCGGTGGCACAAGGAGATCTGTGCCACCGAAATGCAACTTCGGCGCCCGATTTGAGCACTATGGCCGACCGCCAGCAAATTGGAAAATGac
aagacggagaagacaGAGGAACATGGATCTCTCGCAGGCGGAAAGCCCTGCTCGTCGCATTGCCGCGGGATTTGACGCGCGAAGGAAGCAGCGACTGCTC
TCCGCGATTGTTGAATGGCGTAGCATCTCGAGAGCTGCGTCCAGTGGACAGGAGACTCTCCTGAG