Description :
From Genome Similarity Track
Location :
Scaffold_136:36630- 38890
Transcript NameFunction/comments
Hyaar_Emoy2810750hypothetical protein
Hyaar_Emoy2810751conserved unknown protein

Sequence
2260 bases(100 bases per row)
GCCATCCCATTAAGACTCCAGTAGGAGGAAAAGGCACTGGGCTCGCAACAATCTTATGAACCTTACGTGGTATGTGATAGCACCAGCGCATCCCCACCCA
GCTGTGTGTTTTGTTACCCAAGCCCGTGCATAAAGAAGGTTCGCTGCCGGTTTGATGCTCTTTGACGATCCATGGCTCGTTGCACTCCTTGAGGTAGGCT
GTCACATCAGCTAGCTTGATGCCAAACTTGTTCGAATCAATCTGAATCCGAATGTCTGCACCTGCAATCGCAGACGTGTTGGCTATAACGGCGCTCGCGG
TCTCGATCATAAGAGCCTCCGTAAATACGAGCTCCCCGGGTGAAGGTCGTCGTCCTTCTGCCACTCGCCTCAACATCTTAAAATCATCCACCGAAGATCC
TTGTAGACGTTGTATTGTATTTCTAGGACTAGCATACCGACTGGCACAATCCGATCTACTACCACCGCGTGAGCTATAAAAACGTTTGTTACATGGCTTG
TCGCTGGTGGCAGGTGGGTTCAACAGGTAACGCATGGCCCGCAATGAGAAAGATGAAATCTTCACGCGCAGAGCGTTTACTTCGGCCTGGACACTTACCC
GGACCATATCAGTGTACAGTAAATAGACGTCCGTTTCCCCGACCGCCACTCGTTCAAGCATTTGATNNNNNNNNNNGTTATCCGAGCACTGCATTCATGT
AGCAGACGTTGAGCCTCGGACACGACGCTGATATATTTCAAAAACTCCTGCCAAGTACTAAAAGTATTTGCGGGAACAGGACCGGTTAACGTGTTTTGAA
AATGTACCTGCAGGAGAGGCAAGTTGTCGGACGTGTTTACACAAAGCTTGTCAATATTCATCATCATTTCCAGTGTAGGCACAGCAACAAAGCGCGTAAT
TTCATCCACGGTTTGCCCTAGTGACCGGAACAACTCCTGGGTCTTATCATTACCACCAGCTCCCACGCTCGCAAACAATTGACCGGACTTCATCCAAATG
CCAGCCGTTCTCTTTCCCGCATTGGTTTGTCCTCGGTACGATATCACACTTGGAGCTACAAGCACCTTGACATTCCATCTCTGACGGAAAGCGAAGGACT
TGTTATCCCTAGGTAGGCTTATTTGTTCCCTACTTTTATCCCCTCGATAGGGTTTTGAAAACAAAAAAGTAGGTTCTGAGTAAGCAAAGCGAGATAACAC
TTGCACGAACTTATGCGATACGTGCAATTGAACAGCTTGCACGTCGAGAAAAAGCGTTCCATCCGAACAACCTCCAAAATTCCACCTCGCGGCAACCAGC
TTTTCGGGATAGTTTTCCACAGACAAATGCCATAAGCTTGGCTCGGCATTTGGGCCAAAAGCCACTTCCTCGATCGCAACCGCAACGTCTGTCGAGCTCG
GTGCATTATCTTTTGCTCGGTGACCAATTACCAAATTTTGAATAGACGCATAACCAGAAAGCGTTGAACTGTCGTGCGCTAGGGCGATGGCTCCTATGCG
AACATGTATGGCTCCGTCCGAATTAAACGTATGCATCTCGATCCCATCGCACGTGAACGATATTTCTAGTCTGTGCATGTACTCGAGCACTGGAGAACGC
TTCTGTAATGGTGAACGCTGCACTGGCTTTACCTGTGAGGGCCTCACAATGGATCGGATGGAATCGCTGGTCCCTCTACTTACCCCCAACACTCGAGTAA
GTAACGCGTCAAACACTGCTTTATCAAGGTCAAGTCTCCACTTGGTCACTGCAATAGTAGCAAGGATTTTCACTCGTGTACCCCCACCTTCGTTTGTGGC
AAAAGATTCTTCTTCGAGACTGCATGTCACGTTGAGCGGCGACCAAAAGGTCACGACATCTGAGAAATGTGCTACATGTCCCGCCACACGACCGATATGT
CTTTCAAATGGGCCTATCTCTTCGTGCATTTTACCAGCAGACACGAACTCATTAAACTCCAGCTGAGCAATGTGACCCGTAATCTTTCCGGCTCGGCATC
CGATTCGCAGCTGTGACTGGCCAAACCGCTGTGCTTGAACCGTGGCTCGTCTCGGCAAGACCCTCGAGTTGAACGGAGGGTAGCCCAGTCCATCCAGCGA
AATGTCATTTCGCACGGCAGATGCCACTGACAATGATTCTAACACGACAAATGCGTTCCCTGATACTGGCCGTGCTAACATAATACCATCCATGAGAAAT
TCGCTTGGAAGGAACAAGCGAATGCAACCAAACGAAACAGACACTTCTATGGTCGCCAAA