Description :
From Genome Similarity Track
Location :
Scaffold_469:3662- 7363
Sequence
3701 bases(100 bases per row)
CAAGAGTGCGTCAGCTACGACATTAAGTCGTTCTGGCTTATACTCGAAGGAGAAGTTATAATCCACGAAGATTGACAGCCACCTCGTCATCCGCTGCGAG
AGGTGTGGGCTGTTACGGCCGTTCGTAAAGACGCATGGTCCGTATAGACGAGAACGGGTCTATCACCTAGCCGATAGACTTTGAATTTCGCCAAAGCGTA
TTTCATGGCAAGGCGTTCCTTGTCATGAAAGGGGGTGGTTATGTTCTGCTGGTTGCAGCTGGCGTGACTGATAATAGACGACACGTTTCGCATCGTCTGC
ATCGTACTGCATTAATGCACAGCCGATTCACTGGCATCACAAACCACGTGGAATGGCCTGTCTTGGTCTGCAATTATCAAAACTAGCAATCGTATCAATA
TTTTCTTGGTACATTTGAAAGAGCGCTGATAATCGGCACTCCATACCCACTTTTCGTTCTTTTATAATAACCGACAAAGATAAACAGTCATCTCGGCGTA
ATTGTGCGAATATTTGTTCAAGTATGCCGCTATGCCAAGGAACTTTCGAATTCCCTTTACACTTGTAGGCACTAGCCATTCGGTGATCGCTTTGATGTTT
TCCGGATCGGTCCAGACGCCAAGCTTACCTACGATGCAACCAAGAAGTGGTATTTCGCTCGCAGCAAATACACATTTTTGAGGTTGGCGAAAACTTATGC
TCTTGCTTGAGTGTAAGTACCTTCCGGACGTGGAGTCGGTGTACTTCCACATCCGTCTGTCCGTCCATATGCCTGCTATGGACGAACAAATCATCGAAGT
AGATGGGCGCAAACCCTCGTACATATCTTAACCGATTTGTCATACATCTATTTAATGTAGCAGGCGCGTTAATTAGCCCTTGAGGCATCACCAGTCACTC
CCAGATCATACCACTTGGGGTGCTCACTGCGGTATATGGGATGTCCCTTTCGCACATGAGGATTTGATAGAATTTGTCCATCAGATCCATTGATGAAAAG
ATATTACTATATACCATACCATCTATGATGACATCTTTTATCGGTATCGGCGTTTGAGCCGGTACAGTTGCAGCATTCAACTTGTTGAAGGCATGTACCA
TCCGCCATCCTCCTGTGAATTTGTGCACATGAAAGATCGGAGGACTATGTGGGGAAGTCGACTCCCTCACATGGCCGGATGCCAAGCGACCTGCAAAGAA
TTTGTCGATCGCTAGTACTTGTCCACGAGGCAGTGGCCATTGCTTCATGACACAGTGCTTCGAAAACAATTTCAGGTCGATCTCGCGACAAGTACCTTTG
TCTTTAGGTATCTCGCACTGCACTGCTTTTGAAAATACATTCATAAATTCCATCAAACCATCGTAGAGACAATTTGCCTTGAGCTATTCCCACGATTGGG
ATGTCTAACGATCAATCCAAGTCTTCTCATTGAGGACACTCTCGTCCATCTATGATCTAGTGAGAACTCTATCATCTTCGGCAAAGACCATTGTCGATCT
GATATCACTAACGAACTCATCTTCCGCGACGATTTCGCCAATCAGATTGACTTTGCCATTACGCCGATCACGCAAGAACCTCTTTTGCTTCATCTAGGGG
TAACAGAGTGGTGTCCGAAGTTAATTTCGAAGGCGCGATCAGATCAAGTGTATAACTATCTATGCTTGGTCCATTGTTCACCAGGACATTCAATGCCTCT
GTTATCTCATGGGAACTTATTTCCACAGCCTGTTGGGGACTTAATTCCTTAACTGTAGACTCTTGGGATAACTCATCTTCGTATGCTGATTATTCGCAAT
TAATTGGTTACTTCCTGGGTGTTGTCCACTAGAAGGCACCCATTCCCCGGTCTGCTCGAATTATTCGAGCGGTGAGCCGTCAGAGCTTCATGCGTTGCTA
TTCAGTCGCCGTTAACTTGTTCCACAGTGCGATAATTAGTCACATTGCGATTCTTTGCAGTTGTACTTATTACCGAACGACACGTGAGGCCATCGCACTC
ACTTGTAGTACATCCACATGGTGGTGGACGCTCCGAGACGTTCATCAGATGGACGTCTGGTGAGCATGCAGCAGGCCTTTCAACTGTTTGTCGATGCCAG
CTGACTTGTGGCTCGTACCTTCTGAGCCACGGTTAACCAAGGATAGCATCAAATTTGTCGTCCAAGTCCAATTTGATGAAGTCATCGTCGTATTGGACTT
CTTTCAGTGTATTGGTTATTACCACTACACGTTTTACCACTGTTACGGAAGCGCCAGTCGCGAGGAGTACCGTCATTCTCGTTGGAGGGATCTCGCGCTC
GATAAATTAAGGCTTGCTGTCATCTAGCGACTGGTGTCGCACAAAATTGTTCGACGCCCCACAATCGACTGGGCTCGTAGTGACATGTCCTTTACCACTT
CGAGTGTCAAGTTAATGAGATAAACTCATTACAAGATACAGTAACACACAATGATTGCGTGTTGGAATCAATTATTGTCAAGAGGCTTGCAAAATCACTT
GACGTTGCTGGATCAGTAGGGTGCTCCGCACCTACTGACCCTGACCGTTTTTTACTATCCGTTACGATGTTGTATTTTCGCAACAAGGACGAACCCATGC
CTCGGACACCTCTTGGCCGCTTGGCGGATACTGCTTACTGCTGTACGTGATACCGCGTTCGGGGCACTGCATTCGTATGCGTAATGCCCTGAATCTTGAC
ATTTATTGCATCTATGCAATTTCTTATAATTTGTAACGCGAGAGCTTTCACTCTTATCGTAACAGAAGTCCATCGGTTCTGGACCTCTATTATTCTGTTG
CCTCTGGGGACAATAGGAATTCGAATTCATGTGAGCTTGTTTCACGCTAAAATCTTCCTCTTCCGCAACCTCTTCCAGGGGGAACAAATTTAGTCGGAAC
AGGAAGATTTTGACTGGACCGTCTGTGAGACCTTGCATGAACAACGTGATCAACATTTGTTCATTCAGCGGATTTGCTGTAGTGCAACTCGTTAGAGACG
TATGTACTGAATGCATGAGTGTATATCTTTCCCTTGTTTGAGTCTCAGGAGTTCACCGCGAGCCCTAGCGGCGGTTCGAATGTTTGTCTGAGCCGGGATT
TTAAGACCTTTAACGAACCGAAGACATATGGGTCGTGAATCTTGAGGCTCAAGGCCCAAGTATTCGAACGCCCTTCCAAGGCTCGATTAAGCAATTGCGA
CCTGCATTTGCTCATAGACGAGGAGGCGATTCCTTATGGCGTCATCCATTTCAACAAACCATCTCAACAGAGAGACTTCTTTAGCTCCTTTGTACTTGGA
GATATCAGTTTTAAGCGATTCGGGTCTACGTGTGTGTGTCGTCTCGGTAGCTGTAGCCTGCTGCTGTATCAACAGTTCAAACTGTTGAGTACTCTGTTCT
TTCAACAGCTCTGTATGTTGAGACCCTTGTTCGTGAAGCAAGGCTACCTTTACCCGTTCAGCGTCGAGTTCATTCTGAATGGACTTGGCGATGGTGGCGT
GCTGTCCGTCTGAACCCAGAGCGGGCAGCATTGCGCCTATGGCTTCTTGCCCTATCGTCGTACTCAAACGTTCGACGGCATCCCATTCGATTTGACTCAA
ATGGAAGTTTATCTCGTGCGTTGGATAGAAGTCTTTCACTACATCATCCAACATGTTCATAGTCGTTGAACGGACTACAAAGTGCTACCAAGTGTAACGG
G