Description :
From Genome Similarity Track
Location :
Scaffold_1833:3662- 5222
Transcript NameFunction/comments
Phypl_g14229hypothetical protein

Sequence
1560 bases(100 bases per row)
GATTGCATCGCTTGGAACCGTGCTTGTGCTCGAGCGCTCTTATTGAACTCGTAAAGTAAAGTCCCACAGTTGAGTTGAGACACCGGAAGCCATTGTAACT
CGGGATATCCTTTCCATTTAACCAAATATTCTCGGACTCGTTTCGAGGTGCGGGTCCGTTTTACCCAGCGCACGTCCCTGATCGCTTCCACTTCGTACAC
ATCATGGCCTTCACCCGGTTCCGACGCATCTTCTGGTAACAAGGCTGCATCAAAATCATCTTCCTCTGCAAGTTCCACATCAACCTTCGGGCGGTCCGGG
AACAGGGCACGCGGCTTTAGCCTACTCACATGGACCCAGGGATACAATGTATACCCAGAGCCCTCGATCTTCGGTTTACAGCGACAGTCCTCAGGAGCTT
CCAGGATGCGGAACGGGTCATGCCAGTGATGAGCGAATTTCTTGGTTAGCCCAGGTTGGACGCGTCCCAGGTACAACCACACAGCGTCTCCGACCTGAAA
ACCTTTCTTGAGTCGATCAGACAACTCATTCCAGACTTTGGTCTGGGCCTTTGAGCGCTTGGTCTTGGCTTTAGCTTGAAGATCTTTTTGCCCAGGCTTG
GACATACTCATACTGTCGTTGCACCTTGCGGCGCCACTCATAAGCAGTTTTCTGATCAATCCCAGTGGGATGAGGTCCGAGCATAGCGGAGACCGTACTC
TGGGGATCCCAGCCACGAACCAAGTAAAATGGCGTATCTAGGCGTGTGGCGTCGAAGGACGTGTTCAATGCCCACATCAACTTCTCCACCTGATCGTCCC
AGTCGCTTTGATCCGGTTCAGAAACATACGCTCGAATGGCTCGGACGACTGTTTTTACCGATCGCTCCTGCTGGCCATTAGCTTGGGGCCGACACGCGAG
TGTGACCCTCTGCTGACTTCCCAGCATTTCCCGGAATCGAGTAAAAACCTTGCTCATGAATCTCGGGTCCCGATCATGACGCAACATCACACTGGCACCG
AATCTCTGGAACACACACTCCATGTAGGCTTCCGCCACTTCTTGAGCCGTAGTTGTACTCATTGGTCTGCAGATCACGAACCCCGAGAATGAACACTgga
acaacaacaagaacacATTTCCTCGGTCCGACTTAGGTAAGTGTGTCACGAAGTCTATGGAAACCACTTCAAAAGGGCGAGTCGCCAAAATATTCCCGGG
TGAAGGCCCAGGATTCGGCGGAGCTCCCTTCGCAGTGACACAATCCACACATTCCTTGACAAAACGCTCGACATCCGCGTACATCCCGGGCCAGTAATAC
TCCCGTCGCAGTCTCGCACAAGTCCGAGTAATCCCTTGATGGGCTCCTGGGATGTCTTCACGACACAAGTGCAAAAGATCCTCTCGGAGCGTGCTGGGAA
CTACCTGCTTCAGGtttccttcagcttctcgaggTCGACTCGGAGTGGAGCGGCTCAGGTAATAAAGAGCTCCTCGGGCGTCCAGAGTAAACTGGTCTGC
GACCTTAGCCACTTCCTCGGCTTCCGCAGCAGAGAGTAATTCCAGATGCCCTTCCAGGTA