Description :
From Genome Similarity Track
Location :
Scaffold_2068:3662- 4935
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2068-fgenesh-gene-0.0Chromodomain protein

Sequence
1273 bases(100 bases per row)
NNNGATGTGTCCGCTCCCGAATCCAGCAGAGCGCAGACACGGCGACTCCGTCCACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCTA
GCTCCATCACCTTGCCCGCCAGCTTGAGCAACACCACCTGATGCCGCACCTTGACCGGCGGGTGGCGCACCAGCGCGCCCACTACGTCCGCGACCACGAC
CACCACCGTTACCAGGTCCTCGACCACCACCTGGCGGTCCAGCTGGCGGGGGTGGCGTGGCGTGTGTTGACTCCCAGACCATATAGGCCCTAATAAACTC
AACCACCCACTGACAATACCCGACGACGTCCTCCTTGTATCTCTTGTTTCTCGCGAGACCGAGCTGCGTCGTAACCATGGCCTTCAGCGGGGCTGGAGCC
AGAGCGTCGGCCAAGTACCGGACCAGACGCTTTTGTTCCTCCTTGAGCGCGAGGTCGAGAATGTTATACTCGTGCAGGAGCTTNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCGT
TCCAATCCACATGGGAAGGCACTTGAGCCTTCTTGAAGTAAGCGACCCACTGTTCCTCCGTGATCTCGTGGGGTGCACACCGGAACTCGAACGTCGCGAT
CCGGATCTTAGTGAACATTTCGATGCACGCACCGACGGGCATCGCGAACGCGTCGCCACCATGCGCGACGTACACGTTGATGGAGTCCAAATACGCCAAG
TAGTCGAGGATGAACTGCCGACGTTCCTTCATTGTGCTTCCTTGATACCGCGGCGGCTGAGGCAGCGCGGGCATCGTGCCCACGCGCCCCGCTGCGCGTA
CTGGACTCGCCGTCGCCATCGCTTCGTCGTCCGCCTCCTCTGCGGCGGCTTCGTCCTCGTGGCGTGCCGCGCCTGAGAAGACTTCGAAAGGGTTGGGAAT
CCGCAACCGCAGACTTTCCCACGCGCTGGGCGATGGTGCCTGGTCGCCGCCACCGGCGCGCATATTGAGCACTGTCTCGTCCAGCTGGGCCGCGAGCCGA
TCCACGGGATCCGACTAGGACATCTTGAGCTTGTTCCAGTGCCTACGGGCACTAAAGAATTCTTTGATCCGTGTTCACCAGAAGAGAACTTGCACGGCAC
AGTTCTGGTTGCAAACTGATTGATTCTTATGGACCCTTCTGGCCTCCGGTCCTGCCCGGACCTGGCCACACGT