Description :
From Genome Similarity Track
Location :
contig_20:36615- 37619
Transcript NameFunction/comments
g5189.t1hypothetical protein

Sequence
1004 bases(100 bases per row)
CGTTCGACGACAGGTCGGTCACCTCGCCCCGCAGGTACGATTTCATGTTCGCGATCCACTGCTCTTCGTCTTGGGCTTGCGTGATCCGTTCACTTCTGAT
GCGTTGCACGATCGCTTCTTGCAGAACTCTCGGCACTCGTCTCGACCGTCGTGCAGATCGCGTTACCGCTGATACACGAGCTACAGCGTTATTATCCTTC
GGCTTCAGGAGCTCGTCCAGCCGATTGAGTGTGATCAGGTCCTGTCGATCAGCTTCCGAGGTAACTACGGTTCCTTCGCCTCGTTGAAGAGCTTCGCTAG
CTAACTTGTCCGCACTCTGGTTCCAATCTCGTTTCATATGTAAGAACTCGTGTCTTGGCCACGATCGGAGCCGATCCATCGCTTTCTCGCGCAATAACAA
CAGGCCAGGGGCCTTGCATGCGATCTCACCACGCATTTGCCGGATCACTAAATTGGAGTCTCCGCAGATCACGACCCGCCCCCTGTCCATAGTGGACAGG
AGATCGAAGCACAACAACAGTCCGCGATACTCAGCTTCGTTCACCGTCAGATCAGGCATGTACTCCGATGCGGCCGTGACGATCGTCCATCCCGGCAGCT
TCCACACGATCGCGCTATAAGCGCCACCACTGCGTTTGACACGCGCTGATCCGTCGAAACTCGCGACCAGCAAGGCTTCATCCGCTTCGACCGTAGGGGG
TGGCAGGGTGATCGTCTGTCGGGGCTGCTTCACTGGGGCAATCGCGATCAGCGCCTCGTCTACCTCCGCGCGAGGTGTGATGCTTGCTGCGATCGCTCCC
AGAATCTCATCCTCCCCTTTCGTGCACTTCCTGATCTCTAACGTCCATTCTGACAACAAAGCTGCCCAATTACCCAGTCTCCCCTGGAAGCCAGCCGAGT
TGACCAGCCACGCCAGCGTCGAATGTCTGGACAGCACCAAGATCGACCTCGTCGCCAACAGTGTGTAATTCACGTCTAGCATCCGCAGGAGTGCCAAGAC
TTCC