Description :
From Genome Similarity Track
Location :
Scaffold_1388:3661- 5184
Sequence
1523 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTCTTTCCGATGTGACCCAGCTTACATC
AGCGCTCCTTCCTCCTCCCGACCGTCTGTATCATGCGTCGGCCGATCCATTTGCTTGGGGAACGATATGCCATAGTCGCCCCGCTGTCTCTGCCCCAGGA
TCTGGTTGAAGGCTCGAAAGAAATCAGACATAAGGCCCTGGTTCCCGATCATGCCGAATCATCTCACTAGCTCCAAATCTTCGCAAAACGCACTCCTCGT
ACGATTCGGCGATGGTTTGTGCAGTTCTAGACGCGCTAGCTTTGGCTATCACGTATCCGGTAAACAGATCTACCCCAGATCAACAACTCTGTGTTTCCTT
TGAACGACTTGGGCAGCGAGGGGATGTGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGACATTCCCAGGTGACTCCCCTTCGATTGTGGGCCT
GCCCTTGCCTGTCTCACAATCCACACATTCCCCGACATAGCGTTGTACGCTCTTGAATAGTCCCCTTCAGTGGAAACATTCCCGGATCCGTTGATAGGTC
CGACCAATACCCTGATGTCCGCCTTCTAAACTAGCGTGATAGTGATGTAGGACGTCCTGTTGTAAGGTTTCCGGCATCACCAGTCTCATCAATCCATCCC
GATCCTCGTCGACTCTCTTCGTAGGGGGACAATAGAAGAGCAAGTCATTCAGATCCATTGCGTATTCCGTAGCGATAATACTGTAGAATTTGGTATCCTC
CCGACTCAGGTGTCGTACATCCCCCATCAGATACTTCTTTAGTCCCAAGATACACGCTTCTTCGTTCTGTGCTTTGTGAATCCGCTCAATGCGGACTCCC
TTCACAAATGTTTCATCGAGAATCTGGGGGCTGGATCCAATCCTTCCTCTGGACCTAGTGAGAGCCATCACCTGGACCGTCCTTTTCCCGGATCCAACTA
CCACCACTTGGCTTAGTCGGTTTAGTGTGACAAGATCTTGACGCTCAGCCTCTCTCTCCACCTCAACCCCACATTGATTCCGTAAAGCGGCACTGGCCAA
GCTATCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCGTCCAGCCACGCAGGCGGACCATCACTTTCTGCCGTAACAGTGTTAGG
GCCGGGGCCTTGCAGTCGATCTCACCTCGCACCTGTCTGATCACCAAGTTTGGATTCCCACAAACCACCTGCCTTTTTGGATCCTATCCATTTAGTAGAT
CCAAACCCAACAGGAGCCCGTTGTACTCTGCTTCATTGACGGTGAGGCCTTCCGCATAAGTGGATCTGGCCCGTACAACTTCCCATCCGGGCAGTCTCCA
CAGTATTGCGCTGTATGCTCCTC