Description :
From Genome Similarity Track
Location :
Scaffold_182:36608- 38356
Sequence
1748 bases(100 bases per row)
CCGTTTCCCCGGTGCGATCCCCTGAATTCCGGCTGTCGTGAACGTTCATAGCTCTTGCAGCCGCCCCTGACCAAATTGCTCCTCCTCCTGATGTCCCTGC
AGCTCGGAGGATGTCATGGTACGTTNGTCGGCGATCTCGACTGTTCCTTCGTCTTCCAGGGTGCTGTGTAGCTCTATATTGACGTCTCCGGTATTTCCTC
ATCCTCTTCGCCTGGGCTGACCTCCATTGGCTCTTCTTCATGNAGTTCAACNTGGTGTTCTTTTTCCTTGCTCGTGGTGAATCGTAAATGGCAGTAGTGT
TTTGGGCGATATAACAAAACTATTGGTAGCTCATTTGTCGTTGCTGTTCTGCTTTTGCAGTCGTCCTTGATCGCTTGTATCCACTGACTCGCCTGTTCTG
GTCCAAAGTTGCGCTCTTTCGCTGTGCTGTAGGTCTTTCCTGCCTTGGTGACCTGGGTTGGTGTGAATTTTTGGTAAGATGCTTTGGCTAGTCCCTCTCG
CGCAACCACTACAAATATGTTACGTTGCAGAATCTTAGCCAACATTCTCAGTGTTTCATCCGTTCCCCAGTGTCTACTGGCGATGTACCCCTCCCGTTTC
GACTCTGATTTTCCAATGTCGTTAAAATGAGTCTGCAGCGCTTGTGCCGATTGTTGACTTGTCCAAGTCTGGTCTGCTTTCTCCGCTTCGTTTAAAATTG
CTTTTCTCGTCTGGTGCTCAAACTCTTCCAGGAAAAAATGCTCACTTGCTGCTTCTATTCCCTTCTTGAGCTTGCCGGTTAGATTCTCGAGTGTCTTAAC
ATTGCCGCTGTCTTGGAAGTTCCTGTTCAATAAAGCTGATGCTACTGCGTAATATTGGCAGTTGCCATTGGCCGGTGTCAAATTTTCTTGGAGTCCACAC
ACCTTTAGCACCTGCTTTCCATTCAGACGTTCTCCCTCATTTTGCTCATCGTGTAGTTTCGCGATTTTTTTCAGCCCTTGCCGTTCGCCAGGTAGTCGTC
TGTCTGTAATCATCTTGGTGATCATGTTCCGATGCGTCTGCATTTTCTGCGTTCTTTGGCTCAGTGTCACCCTGATTATTTCCGCTGGGGATTGCTCTGC
TTGTGATGTCACTGGTCTTGGCAGGTTTCGCTGCTCGTTGAGTTGTCGCTCTGGTTTTCTGTCGCGATCTTGTTTCCTTGGCGTTGTTGTTTTTCGTTGA
GGTGGTTCTGCTGGTGCTTTTGGTGTAATTGATTTCTCCTGTTTGCTGTCCGTTCGGCGGCTGTGACTCTATCCCACCGTTCTCCATCCTGCTTGACTGT
CTTCTGAGTCTTCCGTCGGTATTCCCTTCGTTGTGGACGTCGTGGTTGGTGGTTCCCTTTGTAGTATTTGGATTCCTGGTCGTTGCTGCTGGTTCATCCG
TCTCCAGTTCTCGCCATCATTTTTCTAGTCCTTCTCTTCAATCCAGTACTCTGCTAGTTGCTCAAAACTCGTAATTGTTGCTGGCTGTCGTGGTAGGGCT
TCAATCTCTGCTGCTGTCACTTGGATGCAGTACTCCGACGTGTTCCAGAAGTCATCGGCCACATTGCATCTGTTTCTTGTGTGCCCACTGGCACCACATT
GAAAACAGGGTGGTGCAGGTTTCTCGTTGGCATGATGGATCAGGATCTTGGTGCCACTCCAGTTGATGAATCTACGTCTTGCTAGGAAGGGGGGCATAGT
TGTGGAGAAGTGACCAGAAGTTTTTGGAGATGGATTGATCGTGTCCGA