Description :
From Genome Similarity Track
Location :
Scaffold_1223:366- 7257
Transcript NameFunction/comments
Phyag_g9948hypothetical protein
Phyag_g9949conserved hypothetical protein
Phyag_g9950hypothetical protein PHYSODRAFT_309159
Phyag_g9951hypothetical protein PHYSODRAFT_309148

Sequence
6891 bases(100 bases per row)
gccgagttacgaacaaaagtatgggtggccggtttattttgaccaggagtgtagTAGATATCTCTTGTAGACATCTCGGTTTACTGCATCGAGGTTCTTC
GTCTCGACAGCGCCAGCGGCACGATTGCAGCTATTACGTTGAGCTACGATTTGCTTGGTAAAATCCCAAATTCCAATCTTGCCACCAAATAAAACCTACC
CATTATTATCAAATctgacaacaacaaaattATAATATGTCAGAGGTTGGATCAGTTAATCAGGATAAACCGAACCAGTTACCTTGGTCTAACCACAGCA
GCTAGAAACATTTTCTTACCGATGAAGCGTTTGCTCTTGTGCTCTCTGTGCGGTATTGTTTCTCCCGATAGGATGTAGACCACCTTTTTGTCCTTGTCCT
CATTAAACCACTTCTCATCCACATGCACAACGTTATACATGGGCGAGAAGTGGGAGGCTGCGACGTCATGAACGACGTTCTTGACAATGTGGCGGATGCG
GCTACACCTGTTATCGGTTGAGTAGAGGGTGAATAGTGTTCGAGTGGCGCAGTAACTGCCCCTTCATGAGAACGTCCCGAATAACTGAGCGGGAGACGTC
AAGCTCCTCTACACTGCTGGTCTGCGTCATGCACCGACGAAGTGGTAGAGCAGCGATGCGCTCCAGAAGCTCAGATCGGTCCAATTTCTCGCGTCCGCAT
GCTTCCGTTCGACTGACAACGCCATCAATTCCCTCGCTCTTTTTCTTCACATTATAGCACGCCCACACGCGGCTTAATGTGCTTTTGTCCACACCAAAgg
cctctgcagcttcaccagtGGCTCCACGATCTGGAACACCCCTCACACTGTGCATCAGCATGGAAAGAACGGCATCTTGGCGCTCAGGATTCGTCAGGTT
TGTTTTGGTAGAGGCTCTCATGGGGCTGGTGTGCAGTGTTAGTATCGTATCGGATTGGGAAATGAGCATGGAAAATGCCAGCTTTCCGCCAACCTTTGCT
GATAACTCCCGCGTTTGTGAAGCGTTTTTGCCGCTTTAAAGACCCCCAGATAGCTGAGATTAGACGGCGTCAATTCCATCTATCAGCGGCGCTAAAGCAA
ACCTCTGGACGAAAACACACCTCATCATAGTTTTTGTTGCATTTATTTCCAACCAGAGGAAGTAAATGGCTACATGCACAAATGCCCTTAACAGTGGATT
TCTGACTCAATGAGACAAGATTTCGGGGTGCTCTAGAGGGCCAAAAAAACGAAATCGACCTGCACAAAGCTGAAAGACGCTTTCAGGCCATCATCACGCG
ATTTTAAGACGAATTAGACCCCCTGTGGTGGCAGTAGATCACCTCGAATCGAAATGTCAAGGATTTCAAAACACGATTTTGCAGGTCAAAAGCAGTTCTT
GGTTCGAGTAACAACAAGAATACGAGCACTTCTCTTTATGTATTTTATACGAGCAAGGAAGGTCTAAATACTGTTGATGAGAACTAGAGCTCGTTTGGTG
CATGGTGAGCTTTCACAGCAGAGCAATGGGCCCGCGAGAATGGTCATTTGTGAGCTTCGTGAGTGTTGCTgtcggcagcaagttgagctTGTTGTGAATC
TGTAAATCACATCATCTGGTTTCACTTGGTTATTGTATACTGCAAAAGATTTGAAGTGATTCTTGTGTAGTAAAACAGTGAAATCATTCGAAAAGAATTT
ATTCGAAGAAAATAATGTCGCCTCGTTAGAAGGTATAGCGCGCCAGCTCGGTTTGGATGCTATTTTCAACAAGCTATATCTCGGCAACCACAGGCACTTA
GAACGTGAAACTACCTCCATTATGCTTGGATTATCGTCGATTTTTCGCAGTATGAAGCTGTAAGACTCGCGAGAAGGTTTAGATCTTTTAGATTTTGGGG
CGTCCCAGAAACTCCCCCTTTTTTCGTCGCATAAGCTCAGAAATCCAGTGTTAAAAAGAGGGGCGCGATAGGTCGCCTGTGattggctggctggctgcaA
TTTTTACGGTACACGTATACTCATTGTTTTTGGCCACACGTTAACCATGTTGGTCTTGCGGACGTCGCGCCGCGCCGTGCGCCTCACCAAGACGCTTCCA
ACCCCGCTGCGATCGCTCTGCACGGCCTCCCGTATCGCCAGTCACTCTGGCAACGCAGCTGCGCTTCAACGGCTCTCGTTCGACTTCCGTAGCCATCACA
ACTCTGGATTCAATGGATCGATCGCTGTTCGTCACTTCAGTTCATCCAATGGAGACAAGGcgcaagaggaggagaagccgctgcagcaaTCCACCGCATT
GGAGGGAAATCAAGTGTACCAGGCCCCCATGTCGCGTGCTGTGCGCCTCATGAAGGCCGTGTCCGTCACGAGTTGCACGCTCACATCCATCGGAATGCCA
GTGCTTTGTGTGGTGAGCGAACAGGACACGTCCACAATCGGCAAGGTTAGTATGCAATGTCTAGTTATTTATTATTTATGAATTCGCGGGATGTTGATAC
ATTGAATATTTCTGCGTACGTGTAGTGGGCTATGTGCGGCACTATTATGCTCTTCGGTTTGGGCACGACGTCGCTGTTCCACTTCCTGTTCAAGCCGTAC
GTGATGCGGATGTGGCTGGCGGACGCGTCGGCGGACACGAACGATGATCCGACTGTGACGGTGGAGACAGTGACGCTGTTTGCTCAGTTGCAGCAGAGTT
CGTTCCGACTGTCCGAGGTGTCTCCTCCTACCCAGGCGATGCACCCGATGGTGTCGTTCCAGGCACGTGGCCGTCACTACTTCATCCACCCGGAGGCTTT
CGAGGACCAGAATCTGCTGAACAAGCTTGTCGGAGCAGGAAAGCGCAAATAAGGTCGCAACTTGTTACTACAGGCACTAGAATATAGTGGAGAAATGGTC
AAGTCTTTTGTAGCATGCGTGATTCGATTAATCTGCTGTGCTATTCGTTTGGCGTGTCACCACCCACCCTTTTCAACATCTTCGATGTAGTCGTAGCCGT
TCAACGCATCTTCACTATCGACCCGGGTGTCATTACGAAGCACGCGAGGTGGCTCCGcttttgctgcagaagcggctgctccatcttcgcTTTCGTCCTC
TTTGTCCGAGAGCTCCGGCATAGACTCCATCTCCTCCGAAATCTCACTGTTGGGATAGCATATATATATATGAGATCCTTTGTCAGCGTCACCAAGAATT
CAAGAAAGCTAACACTAGGCATACCTGgcgatttcttcttcctcttcgaagTCGCTGCTCCCATAGCCATATTCACTGTCGTTGCCACCTTTGCtctctt
cagcttcctcttcatctttttcCGCTTTGGCAAATCCGCCACTGCTCACGAAACTATCCTGCTCTTGAAGTTCCATTTGCAACGACGCTTTCAGTTGCTG
TAGTGTGCCTGTATCATCGTCGGCTTCCATGGCCTGCAACGCAGCATCTAACTTCCTCAACCgttcggcctcctcctcctaCACCACACGAAATACATGT
AAGCTCTTATCGCATACGAACAGCACTGGTGTAGGCGTTTCTTACCGCATCGAAatcatcttctgcatctccatcttcagtAATATTGCCCGGTGCGCCC
ACCAGCGGTGGTAGTGACGGTAATTTTGCAGGTGCTGGGGGTGGTGCAGCTAATGAAACAgtatcttcatcgtcactttcTTGCTTATCCTTGCCGTGAC
TCTCTTCCTCAGCTTTATCATCACCGTCAGATTCTTCTTGTACCCGCGTTGGGTTGACAGCGGCGGCCTGTTTGTTGTCCTTGACGGTGTAATCTCGAct
ctcttcatcttcctcataATTTGTATAATTTGATTCCTCCAATTCCGATCCACTAGGCACCTCTTCCGCCATGCTCTCTTCTATCTCGGCACTGCTCTCA
TCTACTTCACCCTTAGAGTCATTTTTGTTTGCATCTTCGGTTTCTCGCTCCACTCTCTCGGGTTGTTTTGAAGCCAAAGACGGAGTAGGTTCTTCTCGCT
CCCTCGATTTGGCCTTGGGTTCTGGTACATCGtctgtttggctttcttcgtcatcttcatcgtcgaatTGATCGGATTTCATCGTAGCCTCGGGCCTAGT
ACCCACTGGAActtcttgtctttcttggtcatcttcatcgtcgaatTGATTTGGTTTCGTCGTGACCACTGGCCTAGCGGCCACTACAGCTTCACTGCTA
GGTACTCTCGACTCGATTAGTTGGAACAGTGCCGGCTTCTTTGAGAACCCGTCGGTTGCCAACCCgagcttcttcgccaacaaaGCACTATCGTGCTGTT
GATTTTCTGCGTTGGTCTCAGCAAGTAGCACACGTAGTGCATTCTCCCAATGGAAAAACTGCAAGCACTCCACAATCAGAGAAAAAGCAGTTGTCCTGGT
CTCCATGGAGAAGTCACTCAATTTCGGGGCCATCGGACCCCTTGTCTTCACGAAACCTTCTCGCTCGTGCATAACTTCAAAGACCGCTGCGCGAAGTTCT
GCCTTTATCTTGGATAAGATACCTTGAGCGGTGAGTGCCTGTGTCACCTGCTCCTTGAGTGCCAACTCCTCTGCTGTGGGCGGTGGCTGCAACACCGACA
TCATTCTTCTCTTCGACTCTCTCAATACCCAGCAACACTAAGATTGGTAACTCCTCAAGAGGCAGCCGAAACGGCCATTGTTCTTGTTGATACGTTTATC
TGTTTTGCACTTCACTCTGTATACGCACCTGGATCGGCACACAGCCCCTTTCGAAATCGCATTCAACTTGTCATCATCTAGTTGCGACGAGAGCTTCACC
ATCGACGCACATGTCATCATAAAGACGCTCGAAGCCCTGCGGCGTGAATGGTGTGAAGCCCGCGGCATATGTCCATAAGCAGGTGCAGAGCTCGTCAATT
TCGCGAGACGAAGCGTCCGATTCAGCTGTGCCCTCATGCTGCATTACAATGTGATCGATCGCCTCCCCGATAGTACTCACATACTTGAACACCTTCTCGA
CAACAGTCTCGTCCTTCTGGTTGCGGGACCACTCGGCCATTATTTTCattttcttgagcacctgACGAATTTcgcgcagcatcttgtttGGTTTCCACTT
TTCATAGCAATCCTCCGCGGATAGCAGCGGCAATGGCGCCACTTCCACCACAGCACTTTCCACCACGATAGGGGTCTCAGTATTCGTCTTCGCTTCATTA
CGGTCACTTCGCCGGTGTTCTTTCTTCCGTTTTTCCTTCTTACTCGGAGTTTCGCTGCGATGTTTCTTTCGCGACGATGATTGACCTTCATTTTCTATTG
AGGAAGACCGTCTTTTGTGTCGAGACGATGTTGATTGAGCCGGGGAAGCACCCTCAATTTCTCCTTCCTCGGGATCGTTGTCGATGGCATTAGCGTGCGC
GGGGGACCGCGTTACTGGGGGTTTCTGCTGTCGGCCGGAATCCGCCCCTTGGCCATTAGAAGCTCCTGTGCCATTAGCATGACGTCGACCCATAACATCT
TCACCATTCTGTTGTCGTGCAGCGTATCGTTCAGCTGCGCGTGCCATTCGGCCCCCTCCAGTAACTGGACCTGCTGGAACTGATGCTGTCACTCCAGGGA
TAGCCCCACTCTGGATGATAGCACCAAAATGTGCTCCCAGAGACTGGTTCGAATTCGCACCAGAAGAACTCAATGAAGCCGCTTGCTGAACAATACGAgg
atcaccagcatcaaAATCAGGCGCAGGCAATCGCTTCAGCAGGTTTTCAACTCGTTTCCTCAAGCGTTCACCCTTCAACGCTCGTTGTCCCTGGAAATGA
AGCAAGTCATCGTTGAGAATGTCTTCCCAACCTCCAAAGCCGTGCACGTagacgccaagcagcagtgctgcgtcCTTCCGCTGAGACCAGTCGTGTTCCT
TTTCAGCCCAGGTCCAATTAGGCAAGTCCCGTGCATTGGCACCCAGAACAGAAAGATCGCTCTGCTTTGCCACCAATACGTATGCGCCTTGAGCATTCTG
CTGTGCGTTTCCTGATGAGCACCCAGCCGTACGCAACGCGCGCTGAACAGCGACGCGAAGTTTTAAGTTCTCATAAAGACGCTCAATAATCTGAGACGAT
TTTGCCTCGACCTCAGCAATCTTGATATTGTCATGTGGTGGGCGCGCTTCGACGGCCTGCTTCGCTTTCTGACCAATTTCGTTTGCAAGCGTTTGCAGTC
GATCAATGGAGAGTTTGGTGGTCGTTTGCAGATTCGATCGCTCGATAAAGCTGGGCATCTTGTACTTGTCAGCAaaatttgctgctgtcgggTATAAACC
CACATCTGTAAGGTCTCCATAGCGAAGCATAGCACGCAACATGGCGCGCACCACCTTCCCATCCACTGCCGGTGCTGGCGCCGACGTTCTGCTAACACTG
CTGCTGTaaccatcaccaccagcgtcaccTCCATGGTCACTGCTACTGCTGTTTCCTGTAGCCATCCCCATCGAACTCGTCGCAGTCATCAGCTTCGTTT
TACTGGTCATCACCGACACAGGTGGTATCGTCGCACTAGCAACAGTAGAAGTGGTCGTCTTCTTTGGCTTGGCACTTGTTGTCCTTCGTCCATTAAGTTT
CATCGCCAATCGATCATGTGCCGACACCGGTTTCCTCTTAATCGGCAATCGCCCAGTCGTTCCAAACTGACCTAGTGGTCCACCCACCGCCATAGGCGCT
CCACTGTTCAACACTGCCTCAGCTTCCGGAGATCTCACAGGTGAACCTTTCGGCGGTGGAGGACTCGATCTCGCCGCTGGGTTCCCCAACggtttcttcc
tcttttccCTTAAATCTCTCTGGATCTCCTCAATGGTACGTCGGTCTCGTTTGCGAGTGCCCAGAGCCATCATGGACCCTGGAGTCGACTC