Description :
From Genome Similarity Track
Location :
Scaffold_1512:366- 1969
Sequence
1603 bases(100 bases per row)
TACAGCGGGTGTAGAAAATACCCCTCCCCTCATTCCTGACGGATCCTTTTGGAGCCCCCGCCGACAGTAGGAATCTGTTTGGCGCGAAAATTGAACGAGA
CGAAAGCTGTTAACGCGCGCAATATCCTGGAACTTGAAATTAACGTAAATCGTTTGTATAATGATCTAATACCAAAACAAGGTGCGCAAAAAATGACCGC
CCCCATTTTCGACATACtaaaatcaagtcaaaatgATGTGAGTGTTAGTACTTGGTATGGTCACCTTTGGCGTGCTTGACTGCGTCGAGTTGTTTAGGCA
TCGTGCGCACAACGTTATTCACTAGATCACATCGAGCTGAGACCAAATGCGACGCAATTGCACTCGTAGGTCGTCGAGCGATGTAGCTGGGGACCGGTTT
AGCTTGCTCTTCAAAGCCGCCCAAATATTTTTTATCGGATTCAAATCTGGACTTTGAACAGGGTTGCCGAGGTTCTTCGTCTCAAGACACTTCTTGGTCG
CCTTAGCGCGATGGGCTGGTGCATTGTCTTGCACGAACAGCGTAGTCTCAGACAGCCCGTTTAGTGCCTTGGTGATGGGAATTTCATCGCGCAGAATGCG
CTGGTAGTACCGACTCCTCGCAAATACGGAGCGTTCCAACGCCGTTGCCGCAACTTGACCCTCATACCATTAGAGCCTTGCGACCGCTATTGAATGTGGG
CAGGACACATTAAGCAAAAATGCCTCGTGCGCCCTGTGCCACACTGAAACATGACGCGTCGTTCCATGAAGCTCAACCATAGTCTCATCCGTGAACATCA
ACTCCTCCCAATATTCTCCACTGAAGTCACCGTACTTCTTAGCGTATGCGAGGCATTACCTTCTATGCTTGACAGACAGGTAGGGTTTCTTGCGCACAGA
TCACCCGTGGAGGCCCGTCTCACGAATCCTGCCTCGGATGGTACTTCGTGACATGGGCCTCTCAATCTCTTTCTCAACTTGAGTTGCCAACGTTGCCGCG
CTAATGAAGCGGTTAGCTTCCACACTACGTAGGATACGGCGATCAAGAAGCTTGTCAGTTACTTTTGGCGCCCTCGTCGCGGCGGCAGCACCGAATGGCC
ATGTTGCTTGTGGTTGGGATGACCCTTCTGACGGTAGCTCGTGGAATGTTCAGCATCTTACTGATCTTGGGGTATCCAAGACCGATTTTATGCTTCTGTA
CGCAGAGCACCCTCGTGTCATGGGACAATTGATGACGCGGTGGCTTGGGCTTGGTTTGAGGGGGCATGGGAGCCCGGAGAAGTAAAATTGAAAGTGGTta
gagcagcaagacctTCGTCTAGCGCACCGGAACTACAACTCATTGCAGTTAAAACAAAAATATAGTGCAACAATCGTTTCCCATACAAATTATTATAATG
TTGATGGGTGGCTCGAGGAGGGCGGTTATTCTTTGCGCACGTGTTTTGCCTCAACGCTGATTAACGGATCGTTAACGCGATTAGCCCATCAAAACTGCGT
CATCGAAGACGCCATGGAAAACcccgttcttctcgttccGGTTTCGCGCCAAACGGATTCCTACTGCCGGCGGGAGCTCCAAAAGTATTCGTCaggaagg
ggg