Description :
From Genome Similarity Track
Location :
Scaffold_2592:366- 1593
Sequence
1227 bases(100 bases per row)
CGACTACTACTCGTCGTACAATGGTGGGTATGGAAATGGAAATGGATACTACCCGGACTTCTACTCTTCCTACGGCTACCCAAGTTACGGCGGCTACGGC
TACTCCAACTTCGGGTACCCGGGCTACTTTGGTTATGAGTCTGCCACAGCGAGTGTCGGTGCTACTGGTGGCGAGAAAGAGTCTGCGACTGTGTCTACGG
ACGCTGCCGACGTCAGCCGGAGCGCTCACATTCACTGCGAGGGCAGCTGTGTTGCGATTGGTCCGGCGAGTTGACATTTTAGCGTCTGCGGCTGTTAACC
AGTTGGAAGAGTGGCGTAGAGGAGCTTGTGTGGTTGAATGCAAATTGAAAAGTGTGATTGTTTAGCATGTAAGCTGACCTGGGTTCAGGCAGCCCTGGAG
TAACAGGATTTTCATCTCGCGACATCAACATCAGACTGGTGACGCTAGATTGGATACATGTGCCACTTGTACTGATCCGTGGAAATCCAACAACGATGAC
CGTGGCCGCGATAGCTATGGCCACGATGATTATAAGCTCAGCGCCTACAAGCACAAAGGCTACGGATACGGTAGCGGCGACGACTACAAGGGCTATGGAA
GCGGCTACAGCTACAGCTATTAGAGCTATGGAGGCGACTGCGATGATTACTACGGTCACGGCAACGACTACTACGGTCACGGTAACGACTACTACCCTGA
TTACTACTCGTCGTACGATGGTGGCAGGGCATGGCAAATACAATTTGCAATTGTATTGTATGTGGTAACCTCTCCGTAATATGTATGGCAATACGAGACC
TGACAATAGTTGTTATTGCAAGTATTAAAAAGCATTGAACACGAGAGCTGTACTACATCACCTGTCCTTCATCTTCGCCGGAACAGCCAAGAAGAGTCGC
GCTGTTCCACATATCATCGTTAGCGTTGGGAACATGACTCACCAATGCTCTGTCGGACTGCGCAGGGCGGCGAACACTGATTGCCTTGCCTCACCAGTCG
ATCTAGGGCTCGTGCTTCACAAGCCAGGGCATGCCCAGGATCATATCATATGGATCCATATCGAGAACAGTGAGCTGTTCGAGGCTATCAAAGTCTTCAA
ACTTGACGGCTAGATCCACTTGGACGTTGGGGACAGTGACGACCTTCCCATCGGCCATCCGCACTGACACCGTCCCATTGCCCTTGCTTTCTCTCAATGC
ATCGGACAACTTGTTGCTATTACGAGC