Description :
From Genome Similarity Track
Location :
Scaffold_672:366- 1505
Sequence
1139 bases(100 bases per row)
AGCCAAAGCTAATATGTCCTGTGTGTCTGCAGGAGCAGGGTCTTGAATTCGGCTTGTAGCGAGGAGACGTTTGTGGGCTGCGATGCGTTTGTCCAAGACG
CTGCACTTGTGCAGGGAACGCAGCGCGCGCAAAACACTGCCAGCGCCCTTCGCGTTAATGTTCCGCGACTTTAGGAAGTCCAACACGGCATCTTCAGCAC
GGCGACCGGCGTCCAAGACCTGATCTTTGTAGTCTGTAACCGTGGGGTCAAGCGTAAAGCCGTCTTCGAGGAACAGCTTCATGAAGGCAACGACGTGGCG
TGATTCGGACTTCTTTTGGCGGTCAGAGCAGTCCCAGACGCGAGGAACACGGGTGTACCACTCGTACCATGCAGCGTAACTTGCTTCTTCCTCCGTTTTG
GCTTGGGCTCCTTTGCTTGGTCTTCTTTAGCGGGTCTACGCGGCTCCTTAGCTTTCATCTGAGCCGCCTCGACAATCGTCAACCGCGCAGCTAGGGCCTT
GTTTGAGGCAATAAGCTCATGAATGACAGCTAGAAGGTGATCGATGCTTGGGCAGTGGTGTTGGCTTGCATCTTGTGTTTGGGTTTGTTCTTGAGCAGGC
GGAGCGGCTTCGCTGTCCTGCGCGACTGACCACGCAAGCATGTCGCCGATCGGGATGTCTGCAGCACGCAAGCTCTCTTCCACGCGCGTGACAATGGGGG
CCGCGGGTGAGAGCTCCTTGAGCTGCGGGTAGTAATGGACCAGGTACGCAGTGAGGACACTGATGACCTTGGTGCTTACATTTAGACGTTGTTGCTTGAG
ACCTGTACAGGAATTGAATAGGAAGCCCTGCAATCGGCCGAGGCGTTCTTGACTGGCGTGATCAAGCGTCGCGACGTCGATGACCGCTGGAACGTCGTCT
GCCGCCCACCCACTCAAGACCCGGGCCACCTTCCTGTCCTCGCGTGCCGTGTTAGTGATGTAGGCGAAGGCCTTCTTCGCCTTGGTCATATCCCAAGCAC
CGCGATCGAGGATCCACTGGGCGGCGAGGCGGTCATCCCCGTTCGCATGCTGAGCCCCGCCACGCCGGAAGGAGTGCGAGGTCAGGTCAGGGGTGGCTCC
TGCCGGCTCGGCGACGCGCTTGAGCATCCTGTTCACGTA