Description :
From Genome Similarity Track
Location :
scaffold_357:3659- 6443
Transcript NameFunction/comments
Pl_105681actin
Pl_105682Multidrug/Oligosaccharidyl-lipid/Polysaccharide (MOP) Flippase Superfamily

Sequence
2784 bases(100 bases per row)
TCCATGCCCACCATGATTCCCAGGTGCTTGGGGCGACCCACGATCGACGGGAACACGGCACGCGGAGCGTCATCACCGGCGAAACCGGCCTTGCACATAC
CGGAGCCGTTGTCCACGACCAAAGCTTGAACGTCTTCGTCAGCCATCTTGATGGGTTTGCGGGCTTGAGTCTTGGAGAGCTGTTGCCAACAGGAAGAAAA
GAGAAATGAGCCAAAGAGCGAGCCACGTGGATTGACTTGGGATTTCCTCCAGCCACGCGTCAGCTCTCGTGACCATACACAACACAAGTGTAAGAGTGGA
TGTCAACCGTCCCCAAGTCGAAGTGGCAACAACCACCATAGTGAAAGCAAGTGAAACGCCGGTTGCTGCGGTTTCATCGCATTGTGCGGTCAATTTTTGC
ACTGAGTTGTAGGTTTGGGGCTGTCGCTTTTCGGACTTTCCGAACCCGTCAACGGCGCTAGTACTGCGCGTTTGTATGCGGAATTCGGAATTTCTGAACC
CGCCTGAGACAACCCGGCCGTCAGTAGGTACTTTGGCTCGACGGACGCTCAGCTTTTGCCTCAAGCGCGATTTGCAGCAGGCTCTTGGAAACCTGAAGCA
AACTTGTGCCGAAGTGGTTCTCGTTCTCGCATTGGCGCTTGCTTGGCAACTCGCAGTATTGTTGCCGTGGCAACAAGGGCAACAAGTCCATCTTCGTCTT
GGGTACATGTCGTCATCTTTGCCGGAGATAACCGTAGTGACGACGTCCGTATCCTTTTGGGTGGATGCAATATGCAACGAGGCAACAAGGGGCAACAAGT
GCTGCTGCAGCTGGCCGATGTGAGATGCTAGAGATGCCCTAGATCAATGAGAGTACACACCTAACAGTCTGATCGGGCATTCCATATTAATGCCCAGCTG
CAACCTGCAGTCTTATGGTTTTTGATTTGAGACCCTTTTCAATTGCTTTGTTGAAGTGCTCGATGAGATAACACACAACCCGCTCGCCTCGCTATGGCGT
TCACGCTCTACGAAGGGGGCTACACGTATCGTAGCCTATGGAAGGACCGCTCGCTCTATGGAAGCTCTAGCAAAGTCTCCGGCTCCGCCGGTGGTGAAGC
CTAGTCTTTTGTGATCCTCTTGCTGCCTGCTCGCATTGTCGCTGTGACTTGGCCACGCATTGTCGTGCTCTCGATGAGACCGTCACACCACCAGCAAGCC
GGATGCTCGTGTCCGAGCCTGTCTTTTGCCGGCACCGACTCAGACGAACTCAACATTCACAGGCCGTCGACTAATTGTCCCGAGCGACATGCTCGCTCTT
CCCTCATGGCGCAAGGTGCCTGGCTGACCAACGCTGCGACTTGCACTCCATGCGTTGTGTCGTGAATCGGTGTTGTCTCCAAGCAGATATTACGACCACC
GAGGTAAGCATTGTAACGCTGTTCTCTGAACTTCAGCAATAGTGATGATGGAGTTAACCTGAGCTGTACAATTTCGCTGCTTGCTAATTATTGCAAAATC
ATAGTGTTTGGGGCACACGTCCAGTACGAGCTACACGCTGTGCGCTGTCTACGAATGCCGTTGGTGCATCACGAGAAACTATAGCTGGATTAACACATAG
CAAAGCTCAATCAAAACAAAAACATCGTTGGTGACGAGGCCTTTAGAATGTGAGAACGATGATAGAAAGCGATTTTCAGCCTCGGACACGGTAATGTTCA
GCACGTTTAGCTGTGCTTGATGCGTACTCGTTTGCTGTGCGTGTTGAACGTCCAGTGCAGATATCGTATCTAGTGATAATTGACGAGGTTCAAGCGCAAC
TTTGACGTCCCTGCGACTAGGACATCGCAAATCAACATCATTAAAATCGCTTTATCCTCACATTAATTCTGAGTTTATTGTCGCTGGGCAAACGAATTCG
CACAATGTATGTACCAACACTGGTAATGTTACTGACAATACCTTAGTTGCGCATTTAGCATTTACACTAGTTTGTCGTTGGACGAATCGTTTGACGCTTC
AGAAAAATAGCTAACCACGCCATCACTGCTTAATGCACGAGAGAACATAAAGATATGCTCTCAAAATCGAAGTTTCAATCGAACAACGCGCGCGCAACGG
CTAGTGCTGTTCCCGATCCCGTCACGTCTAGTCTGTTCTAACGAATACGACTAAAGTCAGCGTGTTTGACTACTGCTACCTTAATCTGTGTTGGCAATTA
CCTCGGTGCAAAATTTCTCGGTGGGAAGTTGCACTGTGTTCCTGCTTATTATTTACTTTCCGCAATATACACGTCTCTCGCCGTGAAAAAGCATTCCATG
TACTTCTATGTGACTTTTCCCCGGATCATCGAAGCTGTTGCCTGTATTCCCACTTACCAACTTACCGAAGTACAAGCAATATCTGGCGCTAGTCTACCAC
TACAGTAGAACTTCAACTATGCAGCTTCTCTATGTAGTCCACATAAATGACTATCACTTTCGTCCGTTGCATTCATCGTCGATGTAACGACAAATTGCCA
CTTGACTGACTGGTCCACCAGTATTGCTGGTTCAGTATCACTTCAGACAGCATTGTGGTGTGATAGAGCATTTATCATGGCATTTGAGCCTCGAAGTCCA
ACTTTTACGAAATATGGTGGAGAACGCCAACCACTATTGGACTATAAAGACACTGTGGTGGGGATTCCAGGCAGTCTAGAGATTCCAGACGAGGCCGAGC
CCCATGTCGTCGAAGAGCTCAAAACACTCCTAAAACTTGTTTACCCTGTTGTAAGTATCCTTTGCAATTGAGACTCGATGTCAT