Description :
From Genome Similarity Track
Location :
Scaffold_127:3658- 4673
Sequence
1015 bases(100 bases per row)
AAGTTGGATCTGGCAATCTCGCAGATTTTGCTGATCCCGCTACACCACAAGTACACGTCACTCAATTCACCCGATGTCGTTGGATCCCAATACACTTCGG
TCGTCGTATTTACTATCGCTAAACTTTTCTGGGATCTCCTAACCGATTTATGCTGAGGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGCGAATTTGCCCCGGCGCAGCAGGACGCTGCTTACTAA
GCTTATGTCCTTGCTTGGCCCGGAGGGGCGTGGCTCATCCTTGCATCGCAAGGTCCTGAGGCGGTCACCGCCAGGCTGTAATCGTTCTCCCGCTACGAGA
ACGCGCTCTTGGAGCATGTCCAAGAGAAGATGAGGTCCCGCAACGGCGGCAGCGTCGATGACGCGTGAATAGTCTATGAGACTGAAACCGCTCATGGTGA
GCGTAAAAACCTTCGAGGGGAAGGATGGAGAGAATCTCCTTCTCTGGACCCGGGAGGTCGAGATGGCCATGGGATTGGCCCTGCTCCAGTCTGAGCATCA
GCGCGTGGCGCTGGCTATCTCCAGGCTTGGAGGTCGCGCTCGCGAATGGGCACTAGCGTGCGGCACGTCTGTTGACGCTGCATTTCTCACTTGGGATCAG
CTGAAGCAACAGCTTTCGCGCGTGTTCGCGCCGCCCAATCAGGCGTACCGTATCCGGTCGAAGTTCCTTGCTACCCGCCAGGGTAAAAAGGGTTTATTGG
ACTACGTCCAAGAGTTGAGACCTCTTATCGCCGGAATGGCGGCGAACTCTCTTCCTGAACTGGTCAGCGTGGCCGTGTTCATGGAGGGACTTCGTGTGAG
CGCAGCTCGAACGGAAGTGTTCCGTGTACACCCTAACTCTTTCGAAGAGGCGGTGGATGTGGCATTGAATGCCGAGCACAACTTCAGGTCGCGCCGACCT
GGTTGGAGCGCTGGT