Description :
From Genome Similarity Track
Location :
scaffold_299:36573- 38091
Transcript NameFunction/comments
g6993.t1 hypothetical protein PHYSODRAFT_354158

Sequence
1518 bases(100 bases per row)
TCTTGACTATATTTCTGGAGCGTCGACTTCCGCGTCGGCCGAGTGTATCTTGGAACTCCATCGAGATGTTGTCGCTACTTGCAATTTGAATAATGATCCT
TCTAGCGAACTAGTGTTTGGTCAGCATCACGAAAGTAGGAGAGGCACGCGAGAAGAGGGAAACGTCAGGGAAAGGGGGGACACGTTTAGGAGTCAACCAA
AGATAACACTCCTGTCGAATCGGCACTGTCGATTGCAGTTTCCAACGGAATCGAATCGACAAGGACTGGGAGATGCATACCCACAGTTGGTTTAGAAAGC
AAATGACAACATACATTTACCCCACGGATTCGTACATGTTTTGCTGGAATTGTAGTAAAAAAAGCAACTACATGTACAGGTGCAATCTGAAAGATAAGCA
AAGGAAACGATAGTTTGGTGTGCCCACTCACGCTACAGTTTCAACGCTAACTTTGCATTTGTCTTGGTGTGGCGTGCGAGTGACGCACCGTAGTGGATAT
AGTGCTTCAAAATGCGAGCTTCGAAATGGGACGAAAGGCATGACGACGATGAGCGCAACGGAACGAATGCAACTGGTGTGGTTGAAGTTGCCTCCGTTAG
AATGACATGTCACTAAGATGCGGGATCAACCGTACTGTGTACGACAAGTTTATTGTGTCTGTTACTGTTCTACTCTGCAAGATCCAAAGCGGGGGGAGAA
GCCAAGCGGATCGAAAGCCCAAAGCGAAGATGTTCCAGACCAAGTGCGTAGGCGTCTGCAGCAGCGTATCATCATACCCTCGGACACTGCAACTAACTGT
ATTAATGTATCCTCCTGTGCAGCACCGAATATGACCGTGGCGTGAACACCTTCTCGCCCGAGGGGCGACTCTTTCAAGTGGAGTACGCCATTGAAGCCAT
TAAGGTGAGATCGAAGACATCGTTTGCACGCGGTTTATATTTTATTAACGAACTACGATTCGTGTTTGCAACGCTACTCAGATGGGCACTACAGCTATCG
GCCTTCGCACAAAGGAGGGCGTCGTGCTCGCTGTGGAGAAGCGTCTGACGTCGCCGCTGCTCGAGCCTGGCAGGTTGGTGACACCATTCCTTACACATAT
CTAGATGGCTGCTGGATCTAGAAAGTATTGCTAACGTGCTTTATTGTTGTGCAACGTGGACAGCATTGAGAAGATCATGGAAGTGGACCGTCACGTCGGC
GCTGCCATGAGTGGCATCACCGCCGACGCGCAGACGCTAATCGACCACGCACGCGTGGAAGCCACAAATCACTGGTTCTCGTATAACGAGCCCGTACGTG
TGCAGGCACTGACACAGTCCATCTGCGACTTGGCATTGAGCTTTGGTGAAGGCTCGGATGAGAACAACCACAAGCAGAAGATGAGCCGTCCGTTCGGTGT
GGCGCTGCTGCTCGCTGGTGTGGACGAGGCCGGCCCGCAGCTTTTCTTTTCGGAGCCATCGGGCACATACTGGCCTGTGAAGGCCCACGCTATCGGCTCT
GGATCTGAAGGTGCTCTT