Description :
From Genome Similarity Track
Location :
Scaffold_783:3657- 5293
Transcript NameFunction/comments
Pytar_ATCC12531snap_masked-par_contig_783-abinit-gene-0.18R3h domain containing protein

Sequence
1636 bases(100 bases per row)
GAGATGACTTGAGATTATTTGCCTAGCGGTGGAAAGTCGTCATGGTATGATCCGTTCGCTGAGCCCCGTCGCATCTGCTGCTGGTGCTGGTATGAGGAAG
GAGGCAGAGGCGGCGGTGGGGCACCCCCTGCGTAGCCCCCGCCGCCACGTCCTCCGTGGGGCGAGTAGGACGAGTGATAGTTGCCGCCCGGTGGAGGTGG
CGGAGGATGGTGCTGTGCATGGTGGCGGTAGAATTCCGACGAAGGCTGTGGCGGCGGAGGAACCTGATGATGGCGGGGCATCGGGTCTATCCGATTATAC
TCGTTTGGCGGTTGACTTCTTCCCCGTCCAGGATACGGTGGCTGACCAGCTCCTGCGTACCCAAACGATCGCGACCCATCATAATTGTAGTATGGTGGTT
GCTGCTGGGCCCCAAACCTCCCGCCGCCTCCTCCAAAGTGCGGGTCTCGCGCGGGACGGTAGGCGTCATGGTTGCGTGTGAAGTCCGGATCGTTCAGTTC
CTGCTCGCGGTTGCGCCACAGCACCTTGCTCTCTTTCCAATTCTGCGGCTGAGGCTGACCTCGCCCATCGTCGCCTGCGCTCTGTCGGGTGTTGCCGTTC
GAATTGCCATTCTGGCCGCGTCCATTCGCACTCGCACCACCGCCTGCCGACGGACTCGTTTCCCGCTGTGGCCGCTGGGGGTTCGCACCCGCACTGCCTC
GACCACCACGCGCAAACCCACGACTTCCGTCCGGACCTGCGGCCTGCGCGTTACCACCAAACTTGGGGCCAACGGATCCGTTGGACGCTGTCGCCGTCAC
CTTGGCCGTGGCTGTCGCGGTGGTCGCAGAGGAAGTCGAAGACGAGGAAGAGTCGGTCGTCGAGTTGCCGTCCTCGCCAAAGATTCGAGCGCGGGCCTCG
GCATACGCTCGTTCTCGGTCTTCAATCGTGCGCTGCTGGTTCTTGGGGTCGCTCCCCTCGGCGCCGCGGCCGCCGTTGGTTGCGCCACGTGGTGCGCCCC
GCTTCCGCACCATAATCTTGGGTGCAGACGCCGGCGTGACCGTGGGCGGCTGCATGTCAGCAGACAAATCGATGAGCAGGACCCGCGGAAGGGTGCTCTG
CGGCGTCTTGAACAGCGTCACGACACGGGCCGAGTTGCTGTCGTATCCGCTTTGTGACAGATCGGCCGTCTGATGCTCCAGACAGCACCGCTCGGCGAGC
CGATGGACGATGAGCCGATGGTACGACGACAGCGGCGGGAAGCTCAGCTGCGACTCGCGTGGGTTCTTGAGGAACCGCACGATTTGGTCCTCGAGCTTGA
GCAGCGACAGCCGCTCGCGTGCATTCTCCAAACCAGCGAGCAGCACCGGATCGAGTTGCCCAAAGCGCGCGACTGCGGCGGTCGCGGTCGCCGCACTCAC
GGGCTGCGGGTACATGGCGTTTGGGTCGTAGTGTGCGTGCTGTGGCGATGGCTGCTGCTGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGCCGATGG
CTCTGCCACGAGCCGCAGGCTGCCAAACGCCGTCGCGGCGGCGTCGACGTCTTGCTCCTTCGCGTTTCCTGGAGATGGAGCCGTCGCAGCGTGGCGCAGA
ATCGTGGGCACGGCGACCTCCCCCGTCTCCCAGTCG