Description :
From Genome Similarity Track
Location :
Scaffold_82:3657- 5063
Transcript NameFunction/comments
Aphas_H257_15573protein phosphatase 2 putative
Aphas_H257_15574enoyl Coenzyme A hydratase

Sequence
1406 bases(100 bases per row)
CACATGGTAAGAATGCAGACTAGTGCGATGATATACCTCTTTCTCATGTGTGGGATAGGCACCGCAAGAACTAGAGTCGAAACACCTCGTGGAGTCCCTT
GACGCCCTTGTCCGAGAGATAGAAGGCAAATTGCAGCGAGTATACTCTTCACTCGAATAGTCGTTTCAAGGCTAAAACCATCTTGGATAGCTACCGCGAC
ACACTACATCCCGCAACCGCAAAGCAAGTGCCATGGCCCCTGTCCAGCTCCGAGAGACGAAATACATGAACAAGTGGACATTTCAAATGCCCGAGCCAGC
TGCCCCACCAGTCTCCACGGCTACAGCCCCAGGTAACTTGTCACACACCCCGAAACCCCGACCATGAATACACCATATTGACGTTGATTACATACTTAGG
GCCGTCCGACTACGATACCGATAGTCATCGGGCATTTCCAATGCATCAGCCCACCAAACAACCCCACGTGTCCCAGAAACCTATGTCCGATGCCACGCGG
GTCCAAACGATGTTGTCAGACCTTGGATTTGATATGACAAATACTACAACGACCCCTAGTACCAGGACCAACAAGTCCACCCGAAAGGCCACCGTTACTA
CAGCCTCACACGAACAAACTTCCTTGGACGAGTCGCCACCCCCGTTTGATATCGACGAATTCGTTGCCGACGAGACTGGCGGTCCAGCCAACGTGCAGCG
ACATGATCATGCTGCGTCACGGTTGTACTCGACGTCGTTCCTAGACGACCCTGTAGCCCCACAGAATATCGGCCACTCCACATGGCAACGTTTACGACGA
AAACAAGCTGCTCCCATGGAGGTTTATATTGGATTCCTTGTCGTTTGTACGATAATAAGAATACTATGCCTAGTCGGTCCATGTAAGCGACGCCATGGCC
GAAATGTACGACGGCGCTAAGGTGGTGGTACCCTCCATGGTCAAAGTGAAGCCACCCAAATCAGTCAAGGCCGTCAAGACGAAGACTACACCTCGGGCTA
AGACGGTGCGAGTTGCCGACGACGTGGTTGGTGCGACGGACCTGGCGAAGGACACGAACCCAACGCCGACTCCGGTAGCCGCAGGAAATGCAGTGAATTG
GGCCAAACGAATCCAAGCCTCGTACACACCGCTACACTGACGTGGCGTCGCGTCGAAGCTGCAGGATTGAGCCTAGGGTTTGGGTGTACCGTTGGAAGTG
GTCGAGGATTTGCCGTCGGTGGTTTGGGTCGTGGAACGTGGCGCAGTACGACGTCACGAGTTGGTCCGTGGTAATGTCAAAGTACCCAATTTCGACCATG
GCACTGGTGTCCACACACGTGTCGAGTGCGACGGGGTAATCGAGCCATCGAGCGACCGTGGTTTCAGACACTTGCATGGAAGCGGGAGTAGACAGCGCCA
CGACCA