Description :
From Genome Similarity Track
Location :
Scaffold_22:36541- 39215
Sequence
2674 bases(100 bases per row)
AAAGTCCTAACGTAAAATTTGTATAGGAAAAAAAAAGATCGGTGTATGTATATTTGTACAAGATCCTGCAATCGTACGTATTATGGACCCACATGCTTTA
TATCCAGCATGGTGAGTAGATTCCGTAAAGCCCGTACGCGACATCGAGCATGTGCAAATGGCTGTTTTATTGGGAATGAATCGTTTTTGACGGAGTCACG
TACAGAACGGCTACGAAAGCAAATTTGTGTATTGCATCTGTTTGCTAAAAGCAAGTCATTTGGGCTATTACTTACGCAGCTTCACTGCTTCCTACTCTTG
GTGCTCTCTCTCTACCGCGTCGTCACCCCCAGTTTCCGTTGTCTCGTTCTGATCACTATCAGAATTCTCACCACCATCGCTTCCCTCATTGCCGAGCCCT
GCGGCTTCCTTTTCGTTCCCACCGTCCCCCTCCTCTTCACGACCCCCTTGTCCTCCCGTCCACTTTTTTGGTGGCACCCTCAGCTGGATACCGCGGTCGT
GGCGCGGCTGTGGGGCGCTCGCTTCCATTACGCCAAAGCTGGTGCCAAATGGAGAAGCAAGTCTGGTTGTTACTTGGGTAGTATGCTTGGCGCACCTTGT
CGCACAAGCAGACAATGCATTATACGTAAGTAGTAAGAACGATAGAGCATAGAAGCGTACCGTTTGAAACCTTTACTGCAACCGAGACAGTAGAATCGCG
TCACCTGCCGCTCTGTACTGCTTGTTTTCCGTATAGTACAGACCTTGCACTGCCGTTGATGCCGCTTTCGAATTCCATTCACCTCCACCCACTCGTCGTC
CATCTTTAGCTGGTGGGTGGACGGTGGAACGTTGCCAGGCAATGGTGTAGCTGGTCTCGGTGAGTACATCTTTGGACACATACAGTATGAGTTAGCAATG
TGAACAACCAGCAGAATAAGCTCCTTCCTTACCGTGTCTGCAAATTCGGCCGACCCCACTTGTAGTAGCTGGGCTTGCAACTGAGCGATGAAACCGGTTA
GTTTGAATAGTCCCCACAGAATAGACGTTCCTCTCAAGAAGTTGTAGCGAGCTTTGTATCTATTAGATTAGATAAACCAGACCCTTCTACGATGCGCCAA
TTGTCAATGATGCCCTTCCAGCGTTCGGCCTCCTCCTTACTTCGTGGAGGTCGCTGTCCTCCGCGACGGTTTGTTGTAGAAGCTGCGCCAACTGCAGGTG
TAGAACTTGATGAATCGCCAGTTTGAGGTGCATATAGTGACAGTTCATCATGTCGCTCTCGCTTGGGATCTCATCATCCACATCAGCTTTAAAATTATCC
GTGTCCTCGTACCATTCAGCTGACCCAGTGTCTGAATCATCGTAATCCGAATCCAATGCACCACCATCATAGATGGCATCATCTTGTCGGGAATCTTGAC
GGGAATAGAGAGGAGGCGGGGTTGTGGGAACCGTAGTAGTGTGAATAACAGTAGATATATTCAGTGACCTTGCAAAATCAACAGTAATATACAGCATGCT
GTCAGAAATAAATCTCGCACATGCTTGATATCCATCATGTGACAGCGTACCTGGCAGCCGAAGATCGAGGTGGCGTTAGCGATGAAGTCTGTTGCGCAGA
GGAAACACCTTCCGATGTCGGTGCCTGCGTTGTGTTTGCTGCACATGGCGGAGATGGCGACGTGTTGCTATAGTCCTCATCGTCACCAACAAACGCATCG
CTACAAACAATTACGAACATGAAGTGTGAGAAACACATCGTCCGCAAAACGCATAATCTCCTCACCTGACGGCTTCTGCATCAGCAGCAACGTGTGGGCT
AGTTGACCGCGCAGATTTGTCAGCTCTTGAGCTCTTGGATGGTTCTTTTTCGCCGCCTTCTTCGGTGTTGTGATCCCTGCCGCTGTCGCCATGTCAAACT
CAGCGTCGATATTTCCTTGGTTGTCTGCCGTTCGCACGTAATCTTTGTCTCCGCTGTCACTCCCATCCTCATCAGTAGAAGCAGTATCGACAGCAAGCGT
TTCTGCATACAGTGCTGCGACTGGCTCCTTTCCTTTCAATCGCGGCGCTCTTGCCAGCAACTGTAATACCTCATTAGTGCGCCCTTCTTCTGGTACGTAG
CTGAAGCAGGAGGCTTGCGTGAAGCCACTGTCAACCTATGCCGCCTTCCTGTCGTTTCTGACGTAGGAGCCGAAACAAGCGGTTCATCCGCAACTTCGTC
GCCAAAGTCAGCATCGCGGGCACGCGTACCGTCGACATACGCACGGTGCTCTTCAAGCAGGCGGGCGCGGTCTGGGCCTTCCTTTATCTCGAGACGACGC
AGGAACGCCTCCGCTTCAGCGCGCGTGACGCGTCGGGGAGGCATCTTGGTCCCGCGTCTCGTTTGGAGAATGAATGGATGGCTCAGAGGCTTATCGTTTG
AAGCACTGTCTTTACGGCAGCGTATCTCCAAGGTACTTTCTCTTTACAGTTACGACCCGAAGCCCTGTATATTGGGGACTAAACGGACTAAAAGCCCATT
CTATGACGATCCCCACATGCTTCCTTATCAAGCATGTGGAAAAAGTCACATGCTTCCTTATCAAGCCTAAGTGCCGGGGGGGGTTAATGCATAATATATG
GGAGCTCGAGCGCGGGTGAAAATGCATAATGTATGAAAAGAAATTTTATGCCTTCATACTTTAATAATAAAGCG