Description :
From Genome Similarity Track
Location :
Scaffold_1466:3654- 4981
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1466-fgenesh-gene-0.1Pyruvate kinase

Sequence
1327 bases(100 bases per row)
ACGATTGGTTGATATACTGGCGTGAGCGGACGGGTTGCAACGGCTCGCATGTTGCTCATATAACTATCGAGGGCATGGAACGGATGGATGCACGCAGCTC
TTCGCCTCCTCTATGTGTGTGTGTGCTTCCGGAGGTCGTTATACAATGTAATACCTGAAGCACGTACGTATCTGGCAGTGCGAGCTGCTCTCCACGTTAA
TGGCCACGTTGCTGTTAGAAAAAGAAACCTGCTAACAAGAGAGCAAGCGCATTCAGCACCTTGCATGCGATTTGCCAAGGCGCGTTGCGACATTCTTTTC
GTAATTGTATCAAAGACAAGAGCACGCATGCGGATATCATGAGAGCAAAGACGCGTTGCAGTGGCGTAGTTGCATGCGTGCTGAAAAGATACTGTACGCT
CATGGCGTCGTACATCGTCAGCAAAGTGCCCATTGATGTGGATGGTCATGAACACGCCCGCTATGAAAAAGCTCGATATACGTACGTCGAATAGATTTAT
TTGCAGTGTTTGTCGCTGTTTTATTGTTTAATATCGCTACGTTAAGGCAGTGCTACAAGTGCGCGTTTACGCCACGTTTGCCACACGCATCACGATCTGG
TTGCCGAGATCGTCCGAGAGGTTGTCGGCGCTGAGCACGACGACGCGGTCGCCCGGCTGGAGCCAGCCGAGCTTCTTGGCGTCATGGATGGCCTCGGCGG
TCGTTGGGCGGCGGTCGTGAGCCGCTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAGTTGACGGCCGATCTTCTT
GTTGTTGGTGAAGCACATGACTGGCACAGTCGGCTTGTACTTGGCAACCTTGCGCGCCGTGAAGCCCGTGTCCGTGAGCACAATGAGCAGCTTGGCGTTC
ATCTCGTGTGCCGTCTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGCGGGTTGTTGAGCATCGACTCGAGCATCTGCGTCGCGACGATGACGGGCTTGC
CCACGGCATTGCACTTCTCCACCATGTGCTTCTGGTACGTGAGCACCTTCTGCAGTGGCACTTCGACACCCAAGTCACCACGCGCGACCATGATGCCGTC
CGAGGCCTCGAGGATGCTGTCAAAGTT