Description :
From Genome Similarity Track
Location :
Scaffold_674:3653- 9617
Sequence
5964 bases(100 bases per row)
GTCGCGCAGACTGGAGATCTCGTTCTCGATCGCCGCGTGCTTATTCGCGGCGCTATCCGGCGCAGAAAGACTGGAGTCGTACTCTTAATTCACATCCGGG
ATATCGCGAAGGTGATTCGCGCAGGGCTCCCACGTATCTTGGTCCGCCGGAAAGCCAAGCCATCGTACCCTATAGCGGCGCGCGGCGGGAGCCGTGCGAC
TGGTGGACACATGGCGCTGCCCCGACCGACGGGGCGGGTCTTCGTGATCGACCATATTCTCGACTATCCAGCGGATCTCGCCAGCTGAGTCGACAATCGG
CGGGGGACCATCCCGCTGATACGACTGACGTTCTGGTTGGGAGCCGCGAGGAAGATCTCGCGGGGAGCTTCTGGACGGCGTACCAGGAGGCGGAGGAGGC
TCAGGACGCGGCTGCAAAGACCGTGAGGACTGCGACTGAGACTCGTCAGTCGAATCGGGAGCTCTTGGTGCGGTGAGGCTTCTTGAGCGCGCGGTACATG
GTCGTCTGCAGAGCGGGACGGTGGATCAGGCGCCTGGTGTGAATGACGCGATGGCTCGGGGCGCGCGTCGGGCGAGGCGGCCGCTATATGCGCCGGCGGC
TCAGGAGACGGAGTCGAAGAAGGAATCGTAGCGGGCAGGTAATTTTTTAGTCGTCCGACGTAGAACGTCGGATGTAGCCGTAGCGACGTAGGGATATCCA
GCGTGTAAGCCTCGCCAATAATCTTAGTCACCGTAAATGGCCCAATAAAGTGCGGTGCGAGTTTACTCGCGCCGAGGTTGGTTACGACAGAGTCTCTGAT
TCCTGAAGTTGACAAGAGCACTCGATCTCCTGTCGCGAACTTTACTGTGTGGTTGCGGCCGCGCTTGTCCGCGTTTTCCTTCAGCTTGTCGACCGCCGTC
TGCAGCGCGTTGCGGACGTAACGGGCGACTGCTTGGCGCTGGAGGAGGAAGTCCGAGACAGCAGTGTTGTCAGCCGGACGTGCCGGTTGCTTTGGCGCGT
AGTTCGCTGATGGAGACACCGCGTTAGCGATGCCAGGACTGATCAGGGCACGATTCGTCCACGAGGCGAGAGGGGACACCGCGTCGCGGGGAGTCGTCAG
GGCCTTCCTGGTCTGGGCGTGTGTCACCGCGCTAACAGTCGCTGAAGCTGAGGCTGCACTCGAGGAGGAGTCGGCAGCCGGTATGGAAACCCGTTGAGGA
TCTATTACCGGTGTTGGCGCAGAAGGCTTGTCAGCAACCGATATGGTAGCCGATTGTGGTTTCGAAACCGGAGTCGTCACAAAATGGTTGTCGCCTCTTT
CATCCCCACCCAGAGTGGAGCCACACGGCGCCGTGGGACGGTCCACGGCGAGGAGAGCTGGAACGCGAGGGTGCCGAGCGTTGTTGACGAAGAAAGGAGT
CAGCCAGTCGACGCGTGAACCGCGTTGTTCAGCGCGACCTCAGCAAGCGGAAGGAACGAGGTTCCAGCTCGTGAACGACGTCGCGTAACCGCGAAGTACG
TCCTCAAGGACGCGATTAACTCGCTCGGTTTGGCCATCCGTCTCCGGATGAGCAGCCGTCGACATCAGCAGCTTTGTCCCTGATAGCTCGAAGAGCTTCG
TCCAGAAAGCAGACGTGAACCGCGGATCGCGGTCCAAAACGATGGACTCGGGCATGCCATGATGACGGAAGACTGCATCCACGAAGTGCACCGCGGTATC
GGCCGCGGTGATCGTGTCCGGGACCGGGATGAGGTGAACCATCTTGCTGAACCTGTCGACGAATACCAGGACACCGGAGCGCCCGGCGGAGTCGGGTGAG
AGGCCAAAGATGAAGTCCATCGACACCGAGCGCCATGCCTCGGTGGCCACTGGTAAGGGACGCAGGGGAGCCTGCGACGACGCGGACGGTTTCACGCGTT
GGCAGATCTCGCAGGTCCTCACCCACTTGCGCACCCACTTATACATGTGGGGCCAGTAAAAGTCGCGCGACACCGCGGCGAATGTCTTCTCGCGGCTCAA
GTGAGCGCCAAGCGAGATATCGTGGAACTCATGGATGATCTGTGAGCGCAAGTCAGGGTCGTTGGGGACCACTACACGCGAAGCATCAAAGCGATCGATG
CTGTACGTTAACAGCCCGTCTTTAATCCGATACCTATCGGTCTGATGGCGGGTGGAGCGGGACAAATCACTCAGTGTCTTTTCACTGGGCGAGCGGAGAT
GTTCCAGAATACTCGAATAGACCGGATCGAATTCATACGCAGTCCAGATTTCGTCGCGGAGTGGGGTTTCTGGAGACACGCTCGTCAGGTTCAATCCCGA
CGCCAAGCACATAGCACAGTTGTCTTCGTCGTCTTCATCATGCAGCGGTTTTCGACCCAGCGAATCGCGTGGGTCGTAATCTAAACGACGAGACAGAACA
TCGACAAGGATGTTGTTCTTGCCGGGTTTGTGGTGAACCACGGAGTTATACTCGGAGAAGAACGACAACCAGCGGGCCATTCGCTGGGAAAGATGCGGGC
TCATCATCGCTGTCCTCAGCGATGCGTGATCGGCATACACTGCGAAGGTTTGCTCGCCGAGTAAGTACACTCTGAATTTGATCAGAGCGTAGCGCATCGC
GAGAAGCTCCTTGTCATGGACAGGATAGTTGCGCTCCGCTGGCTTTATCTGTCGAAACTGTAGCTGACGACTTGTTCCCGACCTTCTTCGTCAAACTGCA
TCAGCGCACAGCCGATGGCAAAGTCGCTCGCGTCGCAAAGGACATGATATGGATTCGAGTCGTCGGAAAGAGCTAGGATCGGCGCCTCAGCAAGGCTCTT
TTGTACTGAGTTGAAGGCGGATTGGTGCGCGGGTGACCATGCCCATGTGACATCTTTCTTCAGGAGTGATGAGAGGGGCTGGATTAGTCCGGCGTAATTC
TTTGTGTACTTGTGGAGACAATTCGCTAGTCCCAACCACTGACGCAACTCAGTGGGGTTCTTTGGTGTCGGCCATGCGCAGATAGAGGACACCTTCTCCG
GGTCGGCGCGAACGTCGTCCTTGCTCACGAAGCAGCCCACACCGGAATCTCCGGCGCGCAGAAGATACACTTCTTCAGGTTCGCGTACAACTTGTTCTCG
CGCATCACTTGAAAGACCTGTTTTAAGTGCTTCAAGTGGACTTCTATCGCGCTGAGACCACCCTCAGCGCGGCTGTGCACGAAGATGTCGTCGAAGTAGC
TCGGTGCGAAGTCTCGAAGCGGACGCAGCCCATGGGAGACCATGCGATTGAACGTGGCGGGTGCATTCTTCAAGCCTTGTGGCATCACAAGCCACTCCCA
GAGCATACCGCTAGGGGTGCTGACCGCTGTCAGTGGAGTGTCGCTCGGTCTCATCAAGATCTGATAGAATCCGTCGGTCAAGTCGATGGCGCTGAGGACG
ACACTGCCCGACATGGTGTCGAGCACCATGTCCTTCCGGGGAATTGGGGTTTGCGCAGGGATGGTCGCATCATTCAACTTGTTAAAGGCATAAACGATGT
GCTATCCGCCTGTGGCCTTCTTCACACAGAACGTTGGGCTCGATTGTGGAGAGACACTCTCACGCACGTGACCCGCTTTAAATCTATTATCGCAGAGGTC
GTCGATGGCCTTGACTTGGCCTCGCGGCAGCGGCCACTGCCGCGTCACACAGTACTTCGAAGTGGGCGCGAGATCGATCTCGTGGCGGACATCTCGATCG
GCAGGCAGTTCGGCTGGAATCTTATCGGGGAAGACGTCCGCGTATTCGCGGACGGTCTCGTACACTGGATTACCAGACTCGCGCAAGGACTCCCAGGACT
GCGCTGCGAATCGCTCCTCGCGAGCGGACTTCGGTTCGGCGCTCTTGGGACGGGTGGATTGGTCGTAATCACTGACGGCGTTCCCTTCGAAAGGCGTAAA
CGAAGTGTATGTGATCAGGCAGACCTGCTCAACCTCGCCAACCTTGAGACCACGAAGGAAGTTCTTCCAGGAGAGACCTGGAAGCCGGGTGATCGATTGA
GCGTCTCGAGGTGGACACGCAAGCTCGACGGTGCGCTGACGGCGCATGCCATCGTCCACGTGCTCAATGACACAGACCGACTCCGTCTGTGAGGTACCGC
TCGGTGCAGTTTCACGTCGTGGCTTTAAACGACGGCGCTTCGACTTCTTTGCCCGGCGCCTCGAGTGTGTACTCGAGGAAGAAGAATCGCTCTCGCTGGA
CGATGTATCACCCCGCTCTAGGCACTGGAGCTCACTCTCGTCTGTGCCGGTCCCACGCGGGGGCCACTGCTCGACCGCGTGATCGTTTGGCGGGAGCTCC
AACTGCTCGACCACCGGCTCGGGTGACGGGAGCCTCGACTGCTCGACCGCCGTGTTGCATTGCGGGGGCCCATGCTCGACCGCTATGTTGCGCTGCGGGA
ACCCATGCTCGACCGCCAGATTGTGCTGCGGGAACTCATGCTCGACCGCTGTGTGCCCTGCGGGAACCCATGCTCGACCGCTTGCGCGTATTGCGGGAGC
CCCTGCTCGACCGCCATCGTGTTTTTGTCCTCGCCTCGCCGCGAGGAGTCTTCGTGCAATAGCACTGCGCAAGCCGTGCAGAGAAGGCCATCGCTCACTC
TGTGTACAGCCTGCGTCGTGGGAGACCGGTCCACGACGGTGACGTGGGGCCAGTCCTTCTGGGCAACCAGGAGGTGGGTGAACACCTCGCTCACGTCGTA
ACCGCTGCGGTATTTAACCGAGCGGGCCAACCAGTCAATCTCTGGTTGATACCGTGACAGCCACGGGATACCCAGGATGCCATCAAACGCTTAGTTCATC
TCACTCACGAGGAAGTCGTCATTGCTGCGAAAGCCGTCGAACGTGTACGGCAACGTAATCTCGCGCCGCGCGACGTGGCGCGGCTTCCCGTCAGCAAGCT
TGACTACAACCTGTCCGCGACCATTGCGGACAGCGATTTCGCTGGGTAGCGTCGACAAACACGACTCACGGAAGAAGTTGTTTGTCGCTCCTGAGTCCAC
AAGCGCGCGTAGTGGACGTCGGGCGCCGGCGACATGAAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN