Description :
From Genome Similarity Track
Location :
contig_20:36523- 37527
Transcript NameFunction/comments
g4935.t1ABG66536.1 reverse transcriptase, partial [Phytophthora ramorum

Sequence
1004 bases(100 bases per row)
CGTCCGATTGCGGTTTTGTCGGGCAGTACAGCAGGAGTCCGCTCTCGTCCAGCTCGTAATCGCAAGCGGTCTTGGCGCAGGACTTAGCATCGTTCGACGA
CAGGTCGGTCACCTCGCCCCGCAGGTACGATTTCATGTTCGCGATCCACTGCTCTTCGTCTTGGGCTTGCGTGATCCGTTCACTTCTGATGCGTTGCACG
ATCGCTTCTTGCAGAACTCTCGGCACTCGTCTCGACCGTCGTGCCGATCGCGTTACCGCTGATACACGAGCTACAGCGTTATTATCCTTCGGCTTCAGGA
GCTCGTCCAGCCGATTGAGTGTGATCAGGTCCTGTCGATCAGCTTCCGAGGTAACTACGGTTCCTTCGCCTCGTTGAAGAGCTTCGCTAGCTAACTTGTC
CGCACTCTGGTTCCAATCTCGTTTCATATGTAAGAACTCGTGTCTTGGCCACGATCGGAGCCGATCCATCGCTTTCTCGCGCAATAACAACAGGCCAGGG
GCCTTGCATGCGATCTCACCACGCATTTGCCGGATCACTAAATTGGAGTCTCCGCAGATCACGACCCGCCCCCCTGTCCATAGTGGACAGGAGATCGAAG
CACAACAACAGTCCGCGATATTCAGCTTCGTTCACCGTCAGATCAGGCATGTACTCCGATGCGGCCGTGACGATCGTCCATCCCGGCAGCTTCCACACGA
TCGCGCTATAAGCGCCACCACTGCGTTTGACACGCGCTGATCCGTCGAAACTCGCGACCAGCAAGGCTTCATCCGCTTCGACCGTAGGGGGTGGCAGGGT
GATCGTCTGTCGGGGCTGCTTCACTGGGGCAATCGCGATCAGCGCCTCGTCTACCTCCGCGCGAGGTGTGATGCTTGCTGCGATCGCTCCCAGAATCTCA
TCCTCCCCTTTCGTGCACTTCCTGATCTCTAACGTCCATTCTGACAACAAAGCTGCCCAATTACCCAGTCTCCCCTGGAAGCCAGCCGAGTTGACCAGCC
ACGC