Description :
From Genome Similarity Track
Location :
Scaffold_72:365194- 368514
Sequence
3320 bases(100 bases per row)
CGGATGAAGAGACGAAAGAAGATGATTCGAATTGTGGCACAGGTCCGTTAAAAATGTATGTACAAGATTGCAAGGTGGTTTTAACGTGTACATTCTGTAT
TGACTATTATTGTAGTATCACGAAGTGATATGAATGCCTCACCAACCCTCGTGAAGTACGCGATACTTGACTCGGATGGAGATGACGACGAGGGATGCGG
GTGAAACGACGACGAGCTAAATGCGGACGGTGAATCTGAGCTGGACCCGGATGAGGAGCGCCTACAGCCTGATCTGCTGTTCGATGACGCGCTGCTGGAA
TCTGTTGGGGGTGTTGACCAACTTGCATCGGGCAATATCTCGAGCGCCCTGCTCAGAGATATGGCTAACACGGGATGGACACCATTGGTGCAAAAGACGC
CGCACGATTATATGATGGAGCCGTATGAGCAGCGGTCTCCTACATCAATGCAAACCGATTACCCTCGATTGTATGATGGTGTTCACGGGCCTACGGAAGA
GGCATTGCGCGCTGCGGGCACGCCGTTGGGAGCTTTCTTATATTTTGCCCAGCCAACCCTTTGGGAGGCCATTGCAGATACAAGCAATGCTTACTTCGCT
GAGAACATTGACGAGAGAGTAGAAGGTCAGCTCAAGAAACAAGTGGTTCGCTCGCTCAAACATCCGAAGTTCAAGGCCAAAGAACGTGAACAGATAAAAC
TGGAGTTGCAGAAGATGGAGGACATCACGGGCCGAGAGTTGTGCGTATTTATAGGGCTACTGGCAGCACGAACTATTTCTCCAAACAAGGAAAAGCTTGA
ACATAATTGGAAAACGACCGATGAAGGCGCAATCCCGCGAGGTTGCTTCGGACAGTTCATGGTTCGTGATAGGTTCATGCACATATCACGCAACCTACAT
TTCAGCTCCAACAGCGACGCACGTGCACAGCTGGACAAGGCTTGGAAACTTCGACCTGTGATTGACGCCTTGACGCAGCGATTTCAGCGGGGGATACATT
CCACCTCCTGCAATGGCTTTTGACGAAGCCATGCTGCCATCACGGTCCAGATTCAATCGGATGCGAGTCTTCATGAAAGATAAACCTCATAAGTGGGGAA
CCAAGCTATTCATGCTGTGTTGTTCAACGACGGCGTATTGCATCCGGTGAGTTACGAGTGTTCCAACAGGAGCACTCTTTTTTTTGGCTCCTAAGTATGC
TTAACATGTACCTGACATACTAACCCATTTGTAAACATGTATGGACAGTTTTGAGGTCTACTGTGGAAAACAAGAACATGCGGGTGTCAGTGGCGCGTTG
ACAGACTATATGTCTGGGCCAGCAGCAGTTATTCGCAATCTCACGGAGGTGTTTGGGCCTACAGGACCCGGCACAGGTGCCATGAGGCTGATCGTCACTG
ACCGCTTTTACACATCGGTTTCGCTGGCAGTGCAGATGCTAACCATGGGTTTCTACAGTGTGGGTACAGTGCAGACGGATCGTCTTGGGCTGCCAGCGTC
TCTTGTTGGCGAAAAGAAGAAAGGTGAGAAGAAGAAAAAGCCTATAAAAAATCGCCCAGCACGGATCGAACGTGGTACGTTTGATGTAACTGAGCACCGG
CAGATTCCTGGATTTCGGGCGCTGCGCTGGTGGGATAACAAAGCGGTGTATATGCTTGCATCCGGGGGAAGCGTTGAAATGGATCGCGTAGTGCGGCGAG
ACAAGCAGACCGGCGAGCAGGGTGAAGTTGCCTGCCCACGAGTGCTGAAAGATTATCAGACGCTCATGGGCGGAGTGGACGTTCACGACCAGCTTCGTTT
ACAAAGGTAAGTGTGCGTACAGTGTATATACATCTTACTTCGAGTTCTAAACGTGTATGCACATGCTTCATAGGTACTCGCTGCAACTTGCTATCAAGTA
CAAGAAGTACTACAAATCCCTATTCCTAGGGCTTGTCGATCTCGCCATCATCAATGCCTATATCATCTACAATGCTCGTCGCGTTGCAGATGGACAGCGC
AAGCTTAGTCACGTGAAGTTTATCAAGCAGATGCACTTGGAGTTATGCCAGTTGCGGCCCGACGATTGGGAAGGACTGCTTTACGACGAAGATGCGGCAG
CAACACCGTCAAGATCTCGGTCGAGAACGCAACAGCCTGGACACATTCCTGTCCAGAACGACGAGTGGCGCCCCGGTAACAACCAAGCTGGGAGGAAGCG
TCGGACCCGGGTATGCAAGGTGTGCTCATTGCTAAAGGGAACAGATGGGGCGCGTGGCGGGGACTCCTCAATGTACTGCAGTGACTGCAAGCTGGCGACG
CCGTCGAAGAAGCCGAAGGCATGGCGTGTGTTCTTGTGCGACAAGGCTCGACACAGGCACAACGGCGCCCTCATGACGTGCTTTGATATATGGCACAGAG
TGTGGCGAAATGGTACGCTCCTCCCCAAAACTGCGAGAAAGCGGAACATTCGCGCGCGAACCCCAGCTCAAGTATCATTGGCTGCAAGTGACGAGGAAGG
TTGTGTTTCATCGGATGACGAGTCGGCGGGTGCAGGACAGACCTCGCCAAAGCGAGCGCGTACGGTCGAGGCGGAGGAGTAATCGATTGTTGTGTCCGTA
ATTGTTTTGATTTCAGTATACTCAGTTTCAGCAATCACAAGACTGATCAGCATCTGTATTTGAGTAGCACGACTTTGTTCTATGAACGCCTTCTTTTAAC
ACGGGAATGCACCTGTTTTATCAAGGTGTATACAGGTTCCACGATAACACCGCCTTACGTGCTGTTAATAGCTTGGAGATACACGATTGCAGGATGATGT
GATTTCTGAGACTAGGTTAAGTGCACGCCTATCCAACATACACGATATCAAAAAAGCTTAATTTTAATATGTTAACCCTTACCCGGAGATACAAGTTTTT
TAGTCGGATGGGGGCGCGGAGAATGCTTCGAGCTCAAGGGGTTAATAAAACACAATTGTTTTCCGTAGGTTGTAGAATCAATGGCTTGAGTTCTCACCAA
CCACTTCGATGACGAAGCATTTTGCGTTACAGTTACCAGCGAAGCTTGTTTAGGCACCTTGCTAAACGACGTGTTCAGAACCGCCTTCACCAAGTTGTCT
ATATCGTGAGCGAAGCAGTGTACAAATGAAATATGAGGGTGACGGAGTGCTAGAATTCGTCGGGCTCGACCACACTGACCTGCTGTGTCGGTTACAACTG
CACCGAGCTCCCATCCCTTTGACTTGATCTCAATCATCACGTTTTTCATTTGTTGTGCAATAGCAATGCAGTCATGTCATGATCATGTCACCGTCTCCTT
CTCTTGTCGGGGTCGTGTAT