Description :
From Genome Similarity Track
Location :
Scaffold_32:36511- 38443
Transcript NameFunction/comments
Phyta_totarag1634translocation protein SEC63

Sequence
1932 bases(100 bases per row)
TCGCACTCTAtttgtccttcttgctctcctcggccttcttttcagcctcctcctgctcctgctcctgctccaagtcctcatcctcttcctcgctaTCACT
CGAGTCCGCGGCGTTCATCACCTGCTCGAACAGTGTGGGCTCGTTATCTAACTCCAAATCCTCCGGGTGCGGCTTGTAGACCGGCAGTGTGGCTGCGGGG
GCAACATTGAACTGCAGTACGCAAAGCGGAAACACAGTTAGAAAACTGACCAAGACAAATAAACACTATAATATCATAGCCTTGTGAACGAACCTTAGCA
ACAGCGCGCAAGTCCATGCCGACGTATGAGTCGCTCTTGACGAAAATATCCAACTGGTACGTGCCAGCCTTGGGCGgggcctgcagctgcagcttctgtt
CAACCACGCGCTCCTGCGAGGTCATTTTGGCGAAGGCGTGCAGGTGGTTCATCTTCGAGTCGCCCACCACGCAGTACCAGCGCTCCATCTTCGGGTACGG
GAACCGCGGGGCGTACACCAGGTCGCATGTGTCGCCCTCCTTGACGTTCTTGCGGGTCAGCTTGACAGTGACCGTCATGATGTCTCCCTCAGCAATAAac
tcttcatcctccacgCCGATCGAGATCTGCAGCTCCATGTGGggcatcatctccagcacaGTGTTCACCTCTGCGCGGTCCTCGTCCGACAGTCCACTGA
GCCCCTTGCGTTCCTCGGGCTTCATCGCAATGTACTGGTGCATGCTGCGCACGGCGTTCTTGCCCGTGACAATGTGCTTGACCTCCGCCTCCGTCAGGTG
tggcagctgcaggaacggCGGGTCCTTGAACCAGAGTCCCTGCGTCAGGAATTGCTGCATCTCCATGAGGTTCAGCGTGGTCTGCAGCCACGACTTCATG
ACCGAGATCTCCAGCATGCCGTCTACGAGCTGgatggccttcttgagcatCGCGTTGAGGTCTCCCTGCAGCGTGGAgttcagcttctcgcgcagGAAgt
gcgcgtgcagcagcaggttggcCTTGGCGATTGCAGGGTGGTTGTACTTGGGCTTGGCCATCATGTCCGTCtgcttgaacttcttgaaCAGGCCGCCGAG
CTCAGCGTCATCCGTCGAGCGTCTTGGGATCTCGCGGAACTCGGCCGAGCCTGCCAGGATCTCAGGCAGCATGCGCGGGTGCGAGTGCTGCGACATGGCG
AAGTTGTAGAAGCCGTACGTGTCGTACATGATCATGCTGTCTCCGTACTTCTTCGAGTGCGAGTACCAGAGCGCCACGCAGCTCGGGATGGCCACCACGA
GGATGATCAGGtacaggaacagcaccagGTTGTGGTTGGCCGGGTCCAGCAGGAAGGTCGGCAGGCCGATGGACAGCTGCATGGCCTGGCGGCCGTCCGG
GTTGCCGAACTTCTCGTAGTTGGccttggccacctcgtcCGTGAGCGCCTCGTAGGCCTTGGCCACGAGCATGAACTTCTGCTCTGCCACGGCGTCGCCC
TGGTTCTTGTCCGGGTGGTACAGCAGACTCATCTTGCGGTACGCGCGCTTGATCTCGCGCTCTGAGACGCCCGAGGCGATGCCGAGGATGGCGAACGGGT
CGAACGACTTGATCTCCGAGTCatccttgagcagcagcgccatgcgCACGAGCGCGTACCAGACGccggccagcaccaccaggtTGAACACGAAGGGCAG
CGAGAACACATTGCGGAAGGCCGTCTTCTCggcctgcagctgcttgagttTGCGCAGCTCGCGGTCGCAGCGCACGTGGCTCTTGTCCAGGAGTCGGTCC
TTGAGGAACACGCCGTAGAGGATGCGGCGCAGCGACAGGAACGTCACTGGCACGGCGTACAGCGCGCACAGCGACACGGAGAAGTAGTAGAAGGCCGAGT
TGTCGTACTCCAACATGGTGGCCAAGAGGGAG