Description :
From Genome Similarity Track
Location :
Scaffold_136:36502- 39181
Transcript NameFunction/comments
Sapdi_VS20SDRG_16577hypothetical protein
Sapdi_VS20SDRG_1657823S rRNA
Sapdi_VS20SDRG_16579hypothetical protein

Sequence
2679 bases(100 bases per row)
CAAGAGTTGAGCATGGCGCGAGACGCTGATGTAGTTGACCAAGTTGGGGTCTTCGTATCCCGGCTTTGTGTAGTAGTCGGCGATGTGAATCGAACCAGCG
ACGGTGAGGAAGGTGCGCGTCCAGGCAGCGACGTTGTCCCAGTCTTGGAGCCGCTCCCGCGGGTACGTTGACGCGTCCATAGCAACCAGTTGGATCGCAC
TCGGATTCTGTGGTATCCGGAAACCCACACAGATGGAAACTAATTCATTATCCGGATATCCCTGAAATTTGCTGCCAACGAACCAGACAGACAGAGCATG
GGCAAGTGCTCCAAGGACAAGCGCGTACGACGCCACGGCCTCGACAAACAGGTTTCCTCATCCAGCGTACCTAGGACATATACTATCGCAAGGCCAAGGA
ACAGGGCTATCGAGCACGATCCGCCTTTAAGCTTCTTCAGCTCGATGATACTTTCCGCCTACTTCGCGGTACTAGCACTTGGCCATTCTTTTGCAGCACC
CCACCAAGCTGTTCTAGGTGCCACGCGCGTCGTCGACCTCTGCGCTGCACCTGGCGGTTGGACGCAAGTCATCTCTGAGCGACTGCCCCTGGCGTTCGTT
GACAATAACCATGCTACATCATCTTACCAGTACTGGCGCGCATAGGACGGCTGGCGACGTGAGCATCGTAGCGGTTGACCTCATGGAGATGGCGCCACTG
CCTAATGTCGTGCAGATCCAAGGTGACATCACAGCGCAGGCGACGGCGGACGCGATCATTGCCGAGTTCCATGGCGCGAAAGCCCAAGTCGTTGTCAGTG
ATGGTGCCCCGGACGTTCTCGGCCTCCATGACCTTGACGAGTACCTCCAAGCGCAGCTCGTGCTGGCTGCACTCAACATCAGCTTGAATGTGCTAGAAGA
GGGGGGTACTTTCGTTGCCAAGATCTTTCGTGGCAAGGAGGTATCGCGCCTCTACGCACAGCTTGCGCTTTTTTTCGAGTCGGTTGTCTGTGCCAAACCC
AAGGCAAGCCGCAACTCGAGCTTTGAGAGTTTTGTTGTGTGCAAGAACCTGCGGATTCCAAAAGGATACACGCCATCGATGGAGCTCAGCTTGTTCGACC
TGCCATACGAGACCGAGGTGGGCCGCGTGGCGGGGTCGACCCACGTGGCTTTCCAGTCGTGCGGCGACGTCGATGGCTGGGACGCTGACCAGTCGTATCC
AATGGACGATGCCGATGTGCACCACGAGCCGCTGCAGCGCCCGATCAACCCACCGTATGCACTGGCGCAAAAAACGGTTTAAAACCAAATGAACTTCATG
GACGATCTCAGTACTAGTATCATGCATCACAGCAATCTATGCATCACTCATTACTGCAGCACGATGGCGCTTCTTGCCATTTAGGTTCGAAAGAACTCTC
CTTTCAACTTAAAGTGAGGTGCCAAGTCATGTCGAGTGAGAAGTGCATGAACAGATCGGTTGAACACGATGAGAAGATGCAGACGTTTGAATTATTCGGT
GTCGCGAAGAAGCATGCCGAGTTTCTCGATGCAGTCGGGAGGCGCCAAGTACCGTACAGTCCATTTGTCGAGGTCAATTTCGGTGAGCGGTGCCTCCGGA
ACACCAACAACGGGCGACGCGACAGAGAAGAGCGCACTGGGCTGCTTGGCGGCGACGCGCGCGTACAGGACGTCTTCGGCGACGAGATGTGCGAGTAGAG
AGCGCACCTGTTGCAGCGGCAACAGCTTGTCCATGTGTTTCCAGAGGGCCACGTCGTCAGCGCCGGGGGCACCAAGTATGAAATGCAGCGCCGATCGCTG
CATGCGTGTCCACCACTGCACGTTAATGGACCCGTTGAGCTTGAGCCAAGGGTGCGCGGTCTTGCCCGGCGACTTGGTGTCGAAAATGGCTTCATTGTTG
GGTGCGACGACGTACGACTGCACTGTCCAAAACTTCTCGTACGACCGCAAGACGTATCGCGTTTGGACATACGCTTGGACGCAGAGCACGTCGTCCGACA
TCGACTCGATCTTCTCGCGCACCGCATTGTCATCAGCATCAAGCGCAAGAGCAAGCTCCGCGGCGGAGCAACCCTGCTCTGCTGCGGCGTCGAGCAGCCC
GCGGATGGCATCGTCGTCGATTACAAATGTTCTTCGGGCTTTCTTGGTCAGCGGTAGCGGCGCCGTAAAGGCGTCCATTGCGTCCGAGGGCTGCTCAGTC
GGCAGGTTATAGAAGATGGTCGACACGACCCACGGGTCATCCTGCGGCTGGAGTTGATACAAGTGCCCAGCGATACCGAAGCCAGCTCGGTCTGTTGCCT
GCGGTCGCTTACGCTTGTGTGCGATTGCTGATGAGCCCCGCATAGTCGACGACTTGTACTCGATCGAAAATGAGCAACGACCGAGGACGAACGCAGCATG
CGTCAGCGGTGCGCCGACGGTAAGCTGAACGCCGCCGTCGTCATTGTCATCAGCATCTTCGAGCGCATCGTCAACGACAGCAGCTTGCTCCGCAGCCTCT
TCAAACATGGAGAGTGGGAACCGCACGCCGTCGCGCCAAAGCATGAGGAGCTTCCTCGAGAGAACGTAGCCGCGTTGAAGTTGACGGTGGGTTGGAGTCG
TTGCGTGCACGATCCAGCCGCGCAGCCAGAGGAGGCGCCAAACTGTGTTGATTTCCCTGCGCGTCCAGTGCAAGAGCAG