Description :
From Genome Similarity Track
Location :
Scaffold_72:36500- 37802
Sequence
1302 bases(100 bases per row)
TTATTATTGCGAGCTTCCTCCGCACTATAGTGTAAGCTAGTAACGGTATCTCTTACCCCGTTACACCTGGTAGCACTTAGTAGTCCTTTTAACGACCAAG
TCTACGATGAGCCAAGTCCAGATCTCCGGGGCGACCCTGGAGCATGCTGCATTCCCCCATCTCACTCGCGTGGAGTGGGAAGCGCTTCACCGCCTCGTGG
CGGTGTCCGGAGACGCTGTCGTCGCATCGCTGCTGAGCTCACCGACGCCCGACCAGCAACGTCTTGCAGCACAAGAGTTCATGGAACGCGAGCTCGCCGA
TGCGAATCGGCGGGTGTCAACTCCCTCGCGTCCATCCTAGAATGACGTCGTCAAGATGGAGACGTCTACGTATTATGGCGCCGGTGAAAACCGGCTTCCG
CTAAACCGGTGGCTCCGCGAGATCGACATCGCTATCACCTCGCGACGCATCGAGGCGTCATCGGCCAAGATGAACTTCCTCCTCTCCCGGTTAGCCGGGA
AGGCCAAAGAATGGGCCCTCGGGAAGCTGGTTGTCGACCCCGAGGCTTTCCCGACTCTGGAAACTCTCCAGAGCGACTTGCGCCTCGCGTTTGAGCCCCC
GCAAGATGGGTCTCGCGTTCGCGCAGAGTTCTTCGCTCTGCGGCAAGGGCAGATGTCCATGCGTGATTACGTCCAGAAGACGCGACATCTGGCGTCATGC
ATCGTGACCAAGCCAATCGACATGGCTTCGCAAGTCCACGTATTTGTGCTCGGCATGCGCGAGGGTATGACCCGCTACTACCTCACCAGAGCTGAGCCCT
CCTCTCTCGAGGAGGCGTTTGCACTCGCGATTCGCGAGGATTACATGGTAGCTGCATCATACGCCGCAGCCATACCTGCGGAAGCCCGGGAGTCTACCCC
CGAGCCCATGGAGATCGACGCCATCAACGCGTCGAGCAATCGACGTCGCGGGTCCTACCGCGGCAGCTCTGGGCGAAGCAATCGCTCCCTCATTTGCTTC
CGTTGTGGGAAGAAGGGTCATCGCGCGGCGGAGTGCCGCGCGCCAGCTCCCGTCGTCTCTCACGTCGACGCGGAACACTCCTCGGTCGCTACATTCAATA
AAAGGAACCAGGAACGCATGAGGTGGCGGGGGCGCCTTTACTTGGCTTGGAGGGAAGAACCGGGGCCCTCCGGTGGGCAGCCCAACCCTCGAGGCCTCTC
GCGGTGCTCCAAGCACACACCAATGCTACCACTACGCCGGGCGACTCGAGACTGATCATCGTCAGCCTCCACGTCACCGGTACCCGGCGACCACTGCGCG
CG