Description :
From Genome Similarity Track
Location :
Scaffold_31:3650- 7240
Sequence
3590 bases(100 bases per row)
AAGAACTCGAGCGGATGTCGCGGATGCCAGCAAGGGAAGATGGTCCAAAAACCATTTCCAAGCAACCCGGACAAGCCCAAGTACAAGCCATTCGAGTTCC
TGCACTTCGACCTCTGTGGCGCCATGGAGAAAGAGTCGCTTGGTGGCAGCAAGTATCTGCTGCTGATCACGGACGAAGCCAGCGGCTGCATGACGGGATT
CTGTTTGCGCGCCAAGTCGGAGAGTGAAGGCTGTTTGCGCAAGTTTATCGCCAAGGTGGAGCGCCAGTTCGATGCCAGGGTCAAGTTCGTGCGTCATGAC
GGTGCCAAGGAGCTCGCGACCAACTCGCTCAAGGCCTTCTACGACGACCATGGCATCGAAGTTCAACCGACGGTTCCATATGCGCATCAGACCAATGCGA
CTGCGGAACGCGCCAACCGAACCATTGTGACTATCGGGCGCAGCATGCTTCACTTCGCACGTTTGGACAAGACGTTCTGGGCGGAAGCGGCGATGACGGC
GATCTACATCAAGAACCGGCTGCCGTCACCCAAGATCCCAGGTAAGACACCTTTCGAGATTGTGTACAAGAGGAAGCCCAACGTGAAGCACATGCGCGTT
TTCGGGTGCAAGGCCTACGTCCTGACGCCGAAGGAGAAGCGACTCAAGTGGGACCCCAAGGCTCGTGAAGGCATTTTCATGGGCTATGAAGAGCGTTCGA
AGGCGTATCGCGTTTATGACATCGAGGCGGGGCAGGTAGTGATTTCTCGCGATGTCACTTTCGACGAATCCACCTTTGACGACGTCAATATTCAAGATGA
CGGTGAAGATGTCGATGATGCGGCGGATATCCTGGACGACCTCGAGATTTCGGATGACCATGGAACTCGTGAATTCAGGCAGGCGGGGAAACGCAAAGCT
CGCTCCAATCCTGACGAGCGGGAACAAGTTCGTCGACCGCGTCGCAGTGCTGGATTGGAAGAAGCAAGTGCTCCGGGCCATGACTCCGACCATCAAGAAT
CCAAGAATGAAGACAATGATGATGATGACTCGACTCAGCCCATGTATTGGCGTGCGAGTGCGAATGCAGTGGAGACGAATGACAGCGCCGAGCCGAAGAC
GTTCCAAGAGGCTGTGAGCGGCGAAGACCAAGTCCACTGGCGCAAGGCGATCCGAGCAGAGCTCAAGTCGATGCGACTTCGTGGAGTGTTTCGTGGCGCC
AAGTTACCGAACAACCAGCGTGCGGTCGGAACCAAGTGGGTGTTCAAGATCAAGCGTAATGCCGACGGATCCATCGAGAAATACAAAGCTCGACTCGTCG
CGAAAGGATTTGTGCAGAAGTACGGCATCGACTACACGGAGACGTTTTCGCCAGTGGTCAAGTACGTCACGCTACGAATAATCATCGCTGTGGCCAAGTT
CTTCAATTGGCCCCTCGACCAACTTGATGTCGTCACGGCGTTCCTGTACGGCTTGATGAAGGAGAAGGTGTTCTGCAGTGTTCCAGAAGGCGTGGAACTT
GATGACGGCTACGACTGCGTGGAACTGCTCAAGGCGATCTACGGTCTCAAGCAAGCTTCTCGAGTATGGAACGAGACCTTCGACGAGTATGTACGCTCCA
TCGGATTTCGCGTTTCGAGCTACGATCCGTGCCTCTACATCAAGGTTGTCGACGGTGACTGCGTTCTGATGCTGGTGTACGTCGACGATGTATTGGTGAC
CGGAAGCTCTTCGATGATGATCTCCGAAGTGAAGAAGCAGCTCAAGGCACGATTCGAGATGACCGACAGCGGCAAGTGTTCCTTCATTCTGGGCATCGAA
GTGGTCGACAACGCAGACGGCAGAGTCACGTTGTCCCAAGCTCGCTACATCAACGACATCCTGGAGCGCTTTGGCATGCAGAACTGCAAACCTGCTGCCA
GTCCAGTCGACCTCAGCATGAAGCTCGTTGCCAGTGACGCCTCGACCAAGTTGGATGCGCCGTTCCGTGAAGCTGTGGGTGCTCTCATGCACTTGATGAC
GTCGACTCGCCCGGACATTGCTTTTGCTGTTGGATATGTTTCACGATTCATGGAGAACCCTCAAGTCGAGCACTGGATCGCTGTCAAGAGGATCTTCCGT
TACCTTCAAGGTACCAAGTCGCACGGACTCCATTTTTCACCAGGCAACGGAATCGACTTTCGTGGCTATTCGGATGCAGACTGGGCTGGTGACCACAGTG
ACCGCAAGTCGACTTCGGGCTACCTGTTTCAAGTTCTCGGTGGACCAGTATCGTGGGGATCTAAGAAGCAGTCAAGTGTCTCTCTCCACGAGTGAAGCCG
AGTACATCGCACTGAGTCTGGCAATCCAAGAAGGCAAGTGGGTGCACAAGCTTCTGTGTGAGATCCTCGACGCTGCAGGCAAAGACACCCCGGATCTCAA
GATTTTCGAAGATAACCAGTCGTGCATCAAGATGACGAAGAACCCCGTGAACCATGGCCGCGCCAAGCACATCGACATCAAGTACCACCACATCCGTGAT
GAAGTCAAGCGCGGTGAAGTGATCGTCGAGTACTGCGAGACTACGACCATGCTGGCTGACATCTTGACCAAGGGACTCGGCGGACCTTGTCACAAGGATT
TAACGACGGCTCTTGGCGTTCAAGCGTGTTCGCATTGAGAGGGGCTGTTGCAGGTAATCCAATACGATCCCGCGATGATTACGGTAGGATGTTTACGCCA
CCGATGATTAGACGAGTAGGATGATTGGACGAGTACAGAGGGTTGATGATTGGATGCACCAAATGATTGGATGCAAACTAGGTAGAGAAGACAGTGTAAG
TTCTTATCAATCAATCACTTCTGAATTTCCATTCTGCCCCTCAAGTGACTTCCCTCGCCTCGGCCTCCTCGCCCCAAGCTTCGGCAGTCCTCCCCTCGCA
AGACACAAGATCCAACCATCACCTTCTTCAGTTTGCAGTTCTGCATGCCAAAGCGCTCCAGGATGTCGTTGATGTAGCGAGCTTGGGACAACGTGACTCT
GCCGTCTGCGTTGTCGACCACTTCGATGCCCAGAATGAAGGAACACTTGCCGCTGTCGGTCATCTCGAATCGTGCCTTGAGCTGCTTCTTCACTTCAGAG
ATCATCATCGAAGAGCTTCCGGTCACCAATACATCGTCGACGTACACCAGCATCAGAACGCAGTCACCGTCGACAACCTTGATGTAGAGGCACGGATCGT
AGCTCGAAACGCGAAATCCGATGGAGCGCACATACTCGTCGAAGGTCTCGTTCCATACTCGAGAAGCTTGCTTGAGACCGTAGATCGCCTTGAGCAGTTC
CACGCAGTCGTAGCCGTCATCAAGTTCCACGCCTTCTGGAACACTACAGAACACCTTCTCCTTCATCAAGCCGTACAGGAACGCCGTGACGACATCAAGT
TGGTCGAGGGGCCAGTTGAAGAACTTGGCCACAGCGATGATCATTCGTAGCGTAACGTACTTGACCACCGGCGAAAACGTCTCGGTGTAGTCGATGCCGT
ACTTCTGCACAAATCCTTTCGCGACGAGTCGAGCCTTGTATTTCTCGATGGATCCGTCGGCATTACGCTTGATCTTGAACACCCACTTGG