Description :
From Genome Similarity Track
Location :
contig_20:36497- 37947
Transcript NameFunction/comments
g4177.t1hypothetical protein

Sequence
1450 bases(100 bases per row)
GGGCAGTACAGCAGGAGTCCGCTCTCGTCCAGCTCGTAATCGCAAGCGGTCTTGGCGCAGGACTTAGCATCGTTCGACGACAGGTCGGTCACCTCGCCCC
GCAGGTACGATTTCATGTTCGCGATCCACTGCTCTTCGTCTTGGGCTTGCGTGATCCGTTCACTTCTGATGCGTTGCACGATCGCTTCTTGCAGAACTCT
CGGCACTCGTCTCGACCGTCGTGCCGATCGCGTTACCGCTGATACACGAGCTACAGCGTTATTATCCTTCGGCTTCAGGAGCTCGTCCAGCCGATTGAGT
GTGATCAGGTCCTGTCGATCAGCTTCCGAGGTAACTACGGTTCCTTCGCCTCGTTGAAGAGCTTCGCTAGCTAACTTGTCCGCACTCTGGTTCCAATCTC
GTTTCATATGTAAGAACTCGTGTCTTGGCCACGATCGGAGCCGATCCATCGCTTTCTCGCGCAATAACAACAGGCCAGGGGCCTTGCATGCGATCTCACC
ACGCATTTGCCGGATCACTAAATTGGAGTCTCCGCAGATCACGACCCGCCCCTGTCCATAGTGGACAGGAGATCGAAGCACAACAACAGTCCGCGATATT
CAGCTTCGTTCACCGTCAGATCAGGCATGTACTCCGATGCGGCCGTGACGATCGTCCATCCCGGCAGCTTCCACACGATCGCGCTATAAGCGCCACCACT
GCGTTTGACACGCGCTGATCCGTCGAAACTCGCGACCAGCAAGGCTTCATCCGCTTCGACCGTAGGGGGTGGCAGGGTGATCGTCTGTCGGGGCTGCTTC
ACTGGGGCAATCGCGATCAGCGCCTCGTCTACCTCCGCGCGAGTGTGATGCTTGCTGCGATCGCTCCCAGAATCTCATCCTCCCTTTCGTGCACTTCCTG
ATCTCTAACGTCCATTCTGACAACAAAGCTGCCCAATTACCCAGTCTCCCCTGGAAGCCAGCCGAGTTGACCAGCCACGCCAGCGTCGAATGTCTGGACA
GCACCAAGATCGACCTCGTCGCCAACAGTGTGTAATTCACGTCTAGCATCCGCAGGAGTGCCAAGACTTCCTTGTCGACCATCCCGTAGTTGATCTCGTT
GGGCTTCAGAGTACGACTGGTGAAGGTTACTGGCCAGTACACGCCATCATGCTCTTGTACGAGTGCCGCGGAGATCGCCCACTGGCTCGCATAGACTACG
ATCACCGGGTGCGATCTGGATCGAAATGTTTCAGTACCGGGGTGGACACGATCTTGGCCTTCAGCATCGTGAATGCGATTTTCGCTCGGACCCAACGGTC
AGCATCTTCTGCTCGCGTGACAACGCCCCCAGCTACTGTTCGCCGGGGATGGACCTGTTCTGCTGAACTATCTCGTGGAAATCCGCTTCGCGCAGCTCGT
ACAGGACAGCGGCGTAGACCGCGAAGTCTTCGATGAAGCGACTGTAGTAG