Description :
From Genome Similarity Track
Location :
contig_20:36487- 39420
Transcript NameFunction/comments
g4177.t1hypothetical protein

Sequence
2933 bases(100 bases per row)
CGGTTTTGTCGGGCAGTACAGCAGGAGTCCGCTCTCGTCCAGCTCGTAATCGCAAGCGGTCTTGGCGCAGGACTTAGCATCGTTCGACGACAGGTCGGTC
ACCTCGCCCCGCAGGTACGATTTCATGTTCGCGATCCACTGCTCTTCGTCTTGGGCTTGCGTGATCCGTTCACTTCTGATGCGTTGCACGATCGCTTCTT
GCAGAACTCTCGGCACTCGTCTCGACCGTCGTGCCGATCGCGTTACCGCTGATACACGAGCTACAGCGTTATTATCCTTCGGCTTCAGGAGCTCGTCCAG
CCGATTGAGTGTGATCAGGTCCTGTCGATCAGCTTCCGAGGTAACTACGGTTCCTTCGCCTCGTTGAAGAGCTTCGCTAGCTAACTTGTCCGCACTCTGG
TTCCAATCTCGTTTCATATGTAAGAACTCGTGTCTTGGCCACGATCGGAGCCGATCCATCGCTTTCTCGCGCAATAACAACAGGCCAGGGGCCTTGCATG
CGATCTCACCACGCATTTGCCGGATCACTAAATTGGAGTCTCCGCAGATCACGACCCGCCCCTGTCCATAGTGGACAGGAGATCGAAGCACAACAACAGT
CCGCGATATTCAGCTTCGTTCACCGTCAGATCAGGCATGTACTCCGATGCGGCCGTGACGATCGTCCATCCCGGCAGCTTCCACACGATCGCGCTATAAG
CGCCACCACTGCGTTTGACACGCGCTGATCCGTCGAAACTCGCGACCAGCAAGGCTTCATCCGCTTCGACCGTAGGGGGTGGCAGGGTGATCGTCTGTCG
GGGCTGCTTCACTGGGGCAATCGCGATCAGCGCCTCGTCTACCTCCGCGCGAGTGTGATGCTTGCTGCGATCGCTCCCAGAATCTCATCCTCCCTTTCGT
GCACTTCCTGATCTCTAACGTCCATTCTGACAACAAAGCTGCCCAATTACCCAGTCTCCCCTGGAAGCCAGCCGAGTTGACCAGCCACGCCAGCGTCGAA
TGTCTGGACAGCACCAAGATCGACCTCGTCGCCAACAGTGTGTAATTCACGTCTAGCATCCGCAGGAGTGCCAAGACTTCCTTGTCGACCATCCCGTAGT
TGATCTCGTTGGGCTTCAGAGTACGACTGGTGAAGGTTACTGGCCAGTACACGCCATCATGCTCTTGTACGAGTGCCGCGGAGATCGCCCACTGGCTCGC
ATAGACTACGATCACCGGGTGCGATCTGGATCGAAATGTTTCAGTACCGGGGTGGACACGATCTTGGCCTTCAGCATCGTGAATGCGATTTTCGCTCGGA
CCCAACGGTCAGCATCTTCTGCTCGCGTGACAACGCCCCCAGCTACTGTTCGCCGGGGATGGACCTGTTCTGCTGAACTATCTCGTGGAAATCCGCTTCG
CGCAGCTCGTACAGGACAGCGGCGTAGACCGCGAAGTCTTCGATGAAGCGACTGTAGTAGTTCAAACTTCCAAGGAAGGACTGCATCGATCGCAGAGTCT
GCGGGAAGGGAAGGTTGCCTAACACTTCAAGATCTTTCGGATGGGCTTCCAAACCGTCGACGGACACTCGGTGTCCCAAGTAGTCTACTTTTCGTCGGCC
CCAGAAACTTTTGACCACACTGATGGACAAATTCCATCGTTCGCAAGCATCGAGCAGTGCTTCAACCTTCTCACACAGCATGTCCCAAGTGATCGCAGTC
ACCAGAATATCATCGATGTACGATCGCCTTCCCAACACTGACGGTCTCGGCTCTGGTTCTGGCTCGCCTGAATCGAACACGTCGATCGGTTTCGACGGAT
CGTGACCGGCGTGGATTCGGAAGTGTCCATACAGCGCGTTATCAATCAATCGCTGGTAGATCTGTGGCGCATTCTTCAACCCGAAAGGCATACGCGTCCA
CTCGAACAACCCGAACGGTGTGATGAACGCAGAGATCTTTCGTGCGCGTTCTGTCATGGAGACTACCCAGAAGCCACTTGCCATATCGAGTGAGCAATAC
CAGAGCACTTTGTCCAAGTCTTCCAAGAAATCGCTAATCAGCGGCATGGGGTACACCATCAGTCTCGTCAAACTATTCACCATCTTCCGCGAACAGGTCG
CCACCTTCGTGGTAACATACTTCTTCGTCATCCAGCGGTTCCGGATCAACGATCGGAGGCGTTTCGCCTGGGTCATAGACTCCTTCTGGTCCGCAGTCAT
CTCGTTTCGTGTGGCCTGCTCCATTGGCGGAGATTCTCTCGCGTTCTGATCGCCGGTGCCACCTTCCTGATCCCTTGGAGACCCCTCAGTTTCTGGTTTC
ATCTCGGCGGGTCGAGGCACGGTTAGTTGTGCGACGACCGATCTCGAGGTTCCGCGGTCACGACACAGGATTTTCATCGGTGTGTCGTACTGAGGTCGAT
CTACCATGGGTCCGGTAGGAGCGAGTTCATGCTCTTCTACCTCCACACGGTCGGTAGTAGACTGGAAAGCTAGATTCTGCCACTCGGCATACCTGCGCGA
TCCAAGTAACACGAAACCGGGAGTGCGAGGTACGCGTCCTCCTTCAAGCCACATGCCGACATGGGTGTCGTCTTGCAATACTAACTTCTGATCGCTGATA
TTCGTGATCTTCAGATAGCGAGTTTTCCCCAACCTGTCACCAGACTCGGTACCCATCTATCTCCTCGAGTAACCCACAGTTTCCGGTGGCTCGACAAGAT
GAAACCCTTCCGAATTCGATCGACTCTCCGACTTCCAACTGGCAATGTTCTCCGAGCTTGACCTGCGTGACCTTCTCTCGTAGAGTTGACGTCGGCCGGC
TAGCTGAATCCGCACTTCGTCTGGAAGATTGATTGATCCATCAGCCAGATCGAGGCGAATGCCAGCTGGCACCATGAAGTCCATCCCCAGGATCAGGTCT
TGGCCGCCTGTGGGCGGACCAACCCACGCGTCG