Description :
From Genome Similarity Track
Location :
Scaffold_165:36486- 37790
Transcript NameFunction/comments
Phypl_g4549hypothetical protein

Sequence
1304 bases(100 bases per row)
CAAATCCATTCGTTCAGCTCATCGATCGTCGAAAAAATGGTTTGAGAGCATTGATCATGGCGACGAAAGAATTCGCCAACGGATTTTTCAGACGCCCCAC
CAGTGCTGGTGAGCGAGTCATTTGTGTGCTCTGATTCAGGCGGAGCCATTAGAACATCATCCATCAAAATACCACAATTTTGGTCGTCCAAAACTGCCAT
GACTTCtttcttgagctcttcgccaACATCAGATTTTCCGGACCGGAGTACATTTTGAATTAGATAAGGCAGAAAAAAGCGGGATATTTGAGGGCATGTT
GGAAGTGCAGTTCTGCAGGCCCAAAAAATCTTCCTCTCGGGCGGCTGAGAAAGATTAATTAATCGTCGGCACCACATCAATATCCATTCTTCATATGAAG
TCCCATATTTTTCATAAAACGAGATGTCGTCTTGAGGCGGCTGCAGGTTCCGATCAGCGCTTGCTGACGAGCGACGGTCAGATCCACTGCTACCGTTGCG
GCGCGAAGAGCGACTGCCGGATACGGTGTAGTTTGTTGACCAATAGGGTTCAACAAACTGAAGGACATCTTTCCGTTCAAATCTTCTTTTCATCCATTCG
GGCATGGGGGCGCTGGGATCTTGTCTTGCCTTGTACGATGAACCGAAATTATTCGTTGATGCCAAGCTTTGACCGCTATGCTGTGGATCCGCCGTCAATT
CTGCCAAAAATTTCAGCAATTCTTGGATAGCGAATCCTAACGAGTCCGTATTTTCGGGTGCTGAACGGAGCTCCTTTACCAGCCATTTCTCGATCAGTAC
ACACGCTAAATCCTTTGTTGGATATTCGATCTTTTGGTACTGCTTTTCTTTTGCGACTGATGTGCCTCCTTGAGGCCCAGATGTGTAAAACATGTTTAAC
GGCACCCGGGCACCATCAATGGCACCCAAGGCACCCAAACATCGAGCGCAAAGCAGCTTGATTGGTTCATGACTCTCCGTGAGAGAAAGCTGCAAAATAG
ACTGCACCACGCTAGCAACAGCTCTGTCAATAAATATATCTCCTTCGTTCTGCATTAGCGCCTCTAACTCGGCGCCACGCACAACTAAACAGCGTagcag
ctgcgtgagcgccaTTTCACGAACCGCTGCATCAAGATGATTCACGTACGCCGACAGATTCATTAAATATTCGCCCAAGGGCCGGCATCTTGGGTCTCCA
TCTTCCTCGTAAAGAACAACGTAAATCTCATCGAGTTCTGGAATGGACGGTAGCAACGGGATCTTTGGAAATGATGGCTTCAATTCGGCTCCCTTCTCGA
TAAA