Description :
From Genome Similarity Track
Location :
Scaffold_285:36477- 38537
Sequence
2060 bases(100 bases per row)
CACATAGGCAAATGCTCGACGCTCATAAGCAAAGGCTATCGCGTTGCATGAGTATATTCTGGGTTAATTTAGACATTAACAACATCACACTAATTCTTCA
GTGACTGCTGCTGTTGTATAGTGTTATGCAACTTGGTCCAGTTCTCCGAACTGGATTACTAATATCAAAGGGCGAGCTCCAAAGTCTGCTCCCCTATCTT
ATAAGGAAAAGCTGGATGATCATAAGCAAATACTGATCGCGATGCTCTAGCATACTGTACTGGGTTACTACAGATATTAACAGTATCATCTCATTCTTCA
GTGACTGCTGTTATATAGTGTTTTGCTACTAGTATGTACGGAGGATAGAGGTACCGGCAGGTCATTGAACCGCGAGTAACAAACCTCATCAATATAAATC
TCCGGGATACGAACATTGATCGACACAACGATGTCGTACGCGCTGGTCATTGACAACGTGCTTTACAATAATATATTTTATTGCGAGCCCGAAGGGTGAA
CCTCTAGCGACAGAGCGCAAGGTACCTGAAAATACAGAACTTGATTCAGTTCTATGAACTATATTTCTATTATTAAAGGACGAGATCCAGATCTTGCTCC
CTTGTCTTATCTTTATCCAGCGATTGTTTGCGCTGTGAGTAGGTGCACCGCATTATTATGTGGATAATATCTTTTATCCAAGGCGTTTCCGCGTAGTAAG
TAGGGGGTGTCTACCTAGTCAGTCCCGTTTTAGACTACGCTGAATTTTTACTTATGATCATACCAGGACCGCGTCCTAGCACAACTGGATTCTGAAAAGC
GTCGGTTTGACACAAAGCATGCTCAAGAGGATAGCGGCGGTACAGACAGCGGACTTCTCTGGAAATAATTCCACTGGCCGTATTCATTAGCAATATACTA
CTGATGGACTGTCACAGTAGCAACAGTGCTGTTATCAAACAGAAGGGTAATTGCGTAATCGTTAGCCACTGTCTCACTTTTGACTGTGACGGTGAATGGA
CACTAGTAACTGCTTGTTGAACTGCGACGATTCCCTCGCCCTGCTCCTTATAATTAGCTCTGTCGGTTATTCGCTGACCACCATGAGAGCAGATAGCCGA
GCTTTTCTGGTCTCATCTGCGCGGCACTTCTTTGAGCGTCTTCTTGATAGCGTGTACCCATCATTTATCGTATACGTATCTATCACTGTTATCGTGGCCG
CCAGCGGCGTCTAGATATCCTCTCCAGGCGGCACGGGCAAGTGCCATTTACGGGATGAAAATCACTATATATCTACTGTTTGCCATAGGTGCGAGGCTTT
TGCTGTCATTATGTGTCGAACATTTGCTTAAGAGTCTCTGTCCACCCTTGGTCGACCTTGAGTCGATCATGTGCGAGCATCGGTGCGGCTGTGTGACAAA
GATTGAACCGCTAACATTTTCGGTGTAAACAAAAAAAATTATGAGGTCGCAAGTAGTGAGTGACCTTATCGTTGTGCTGCGCCTGTGTTGCACACCTACC
TATAGGAAGATGTGCTACATCGCACATAGTACGACGTGTAAGGTGCACCTAGCGTGCTGTACACACACATAAACTGACCCCAACGTATATTTTGAGAAAC
CCCAGCATCCACCTTGCGCACCATCACTATTAGCTTCATCCTTTATGCTTGCAACCACTAAGAGTGTGAAGCAATTAGTTTTACCCTTCCAGATAAAGGG
CAATTCAAATAACTTTAGGGAAAGGTTAAACGTACCGGTCGCGAGTGGGTCATTGTACCGGCAATTTGTTTTGGCCAATCAAAAGTATGACTTCTAATCT
CAATCTGTTATGCCCAATCTAATTCTGATGATACCATCCTAATTTTGGTATACCTACCCCACTTCGAGATTTTATTTGCGATGAGCTACGAAGGCCGAGG
TAATTAATAGGACGCAGAGAGTAGCGATTAATAACACCAATTAATAAACAACATATTTTGGTTCCGTTGATGTGACACTAATACTTGCGGAGCACACTGC
ATTTGTTTGAGGCGTACATATACATGCCACATAACACTTATGTGTGTCGGTTTGCTTTTC